Question: 156. Which one is the correct product of DNA dependent RNA polymerase to the given template? 3’TACATGGCAAATATCCATTCA5′
(1) 5’AUGUACCGUUUAUAGGUAAGU3′
(2) 5’AUGUAAAGUUUAUAGGUAAGU3′
(3) 5’AUGUACCGUUUAUAGGGAAGU3′
(4) 5’ATGTACCGTTTATAGGTAAGT3′
Answer: Option (1)
Explanation:
DNA dependent RNA polymerase synthesizes an RNA strand that is complementary to the DNA template and antiparallel in direction.
The given DNA template strand is written from 3' to 5',
so the RNA will be synthesized from 5' to 3'.
During transcription, base pairing rules are: A pairs with U, T pairs with A, G pairs with C,
and C pairs with G.
Applying these rules to the template sequence 3’TACATGGCAAATATCCATTCA5′ gives the RNA sequence 5’AUGUACCGUUUAUAGGUAAGU3′.
Therefore, the correct product of DNA dependent RNA polymerase is option (1).