Sankalp NEET Full Test-1 Solutions

Please Note:

(1) This answer page is long and contains multiple equations and images. (2) It may take a few seconds to load completely, especially on mobile devices. (3) Please scroll slowly and smoothly to allow equations and images to render properly.

Question 1: A bob is whirled in a horizontal plane by means of a string with an initial speed of \omega \mathrm{rpm}. The tension in the string is T . If speed becomes 2 \omega while keeping the same radius, the tension in the string becomes :

(1) T

(2) 4 T

(3) \frac{\mathrm{T}}{4}

(4) \sqrt{2} \mathrm{~T}

Answer: Option (2)


Question 2: A particle moving with uniform speed in a circular path maintains :

(1) constant velocity

(2) constant acceleration.

(3) constant velocity but varying acceleration

(4) varying velocity and varying acceleration

Answer: Option (4)


Question 3: A logic circuit provides the output Y as per the following truth table :

\begin{array}{|c|c|c|} \hline A & B & Y \\ \hline 0 & 0 & 1 \\ 0 & 1 & 0 \\ 1 & 0 & 1 \\ 1 & 1 & 0 \\ \hline \end{array}

The expression for the output Y is

(1) \mathrm{A} \cdot \mathrm{B}+\overline{\mathrm{A}}

(2) A \cdot \bar{B}+\bar{A}

(3) \overline{\mathrm{B}}

(4) B

Answer: Option (3)


Question 4: In the above diagrams, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions :

(1) AB and DC

(2) BA and CD

(3) A B and C D

(4) BA and DC

Answer: Option (1)


Question 5: Given below are two statements: one is labelled as

Assertion (A) :- The potential (V) at any axial point, at 2 m distance ( r ) from the centre of the dipole of dipole moment vector \overrightarrow{\mathrm{P}} of magnitude, 4 \times 10^{-6} \mathrm{C} \mathrm{m}, is \pm 9 \times 10^{3} \mathrm{~V}.

(Take \frac{1}{4 \pi \epsilon_{0}}=9 \times 10^{9} SI Units)

Reason (R) :- V= \pm \frac{2 P}{4 \pi \epsilon_{0} r^{2}},, where r is the distance of any axial point, situated at 2 m from the centre of the dipole.

In the light of the above statements, choose the correct answer from the options given below :

(1) Both A and R are true and R is the correct explanation of A.

(2) Both A and R are true and R is NOT the correct explanation of A.

(3) A is true but R is false.

(4) A is false but R is true.

Answer: Option (4)


Question 6: Match List-I with List-II

List-I (Material)List-II (Susceptibility (\chi))
A. DiamagneticI. \chi=0
B. FerromagneticII. 0>\chi \geq -1
C. ParamagneticIII. \chi \gg 1
D. Non-MagneticIV. 0<\chi<\varepsilon
(a small positive number)

Choose the correct answer from the options given below:

(1) A-II, B-III, C-IV, D-I

(2) A-II, B-I, C-III, D-IV

(3) A-III, B-II, C-I, D-IV

(4) A-IV, B-III, C-II, D-I

Answer: Option (1)


Question 7: In a uniform magnetic field of 0.049 T , a magnetic needle performs 20 complete oscillations in 5 seconds as shown. The moment of inertia of the needle is 9.8 \times 10^{-6} \mathrm{~kg} \mathrm{~m}^{2}. If the magnitude of magnetic moment of the needle is \mathrm{x} \times 10^{-5} \mathrm{Am}^{2}; then the value of ‘ x ‘ is :

(1) 5 \pi^{2}

(2) 128 \pi^{2}

(3) 50 \pi^{2}

(4) 1280 \pi^{2}

Answer: Option (4)


Question 8: In a ideal transformer, the turns ratio \frac{\mathrm{N}_{\mathrm{p}}}{\mathrm{N}_{\mathrm{s}}}=\frac{1}{2}. The ratio \mathrm{V}_{\mathrm{s}}: \mathrm{V}_{\mathrm{p}} is equal to (the symbols carry their usual meaning) :

(1) 1: 2

(2) 2: 1

(3) 1: 1

(4) 1: 4

Answer: Option (2)


Question 9: In a vernier calipers, ( \mathrm{N}+1 ) divisions of vernier scale coincide with N divisions of main scale. If 1 MSD represents 0.1 mm , the vernier constant (in cm ) is :

(1) \frac{1}{10 \mathrm{~N}}

(2) \frac{1}{100(\mathrm{~N}+1)}

(3) 100 N

(4) 10(\mathrm{~N}+1)

Answer: Option (2)


Question 10: A horizontal force 10 N is applied to a block A as shown in figure. The mass of blocks A and B are 2 kg and 3 kg , respectively. The blocks slide over a frictionless surface. The force exerted by block A on block B is :

(1) zero

(2) 4 N

(3) 6 N

(4) 10 N

Answer: Option (3)


Question 11: If \mathrm{x}=5 \sin \left(\pi \mathrm{t}+\frac{\pi}{3}\right) \mathrm{m} represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion respectively, are :

(1) 5 \mathrm{~cm}, 2 \mathrm{~s}

(2) 5 \mathrm{~m}, 2 \mathrm{~s}

(3) 5 \mathrm{~cm}, 1 \mathrm{~s}

(4) 5 \mathrm{~m}, 1 \mathrm{~s}

Answer: Option (2)


Question 12: The terminal voltage of the battery, whose emf is 10 V and internal resistance 1 \Omega, when connected through an external resistance of 4 \Omega as shown in the figure.

(1) 4 V

(2) 6 V

(3) 8 V

(4) 10 V

Answer: Option (3)


Question 13: Given below are two statements:

Statement I : Atoms are electrically neutral as they contain equal number of positive and negative charges.

Statement II : Atoms of each element are stable and emit their characteristic spectrum.

In the light of the above statements, choose the most appropriate answer from the options given below :

(1) Both Statement I and Statement II are correct.

(2) Both Statement I and Statement II are incorrect.

(3) Statement I is correct but Statement II is incorrect.

(4) Statement I is incorrect but Statement II is correct.

Answer: Option (3)


Question 14: If c is the velocity of light in free space, the correct statements about photon among the following are:

A. The energy of a photon is E=h v

B. The velocity of a photon is c.

C. The momentum of a photon, \mathrm{p}=\frac{\mathrm{h} v}{\mathrm{c}}

D. In a photon-electron collision, both total energy and total momentum are conserved.

E. Photon possesses positive charge.

Choose the correct answer from the options given below:

(1) A and B only

(2) A, B, C and D only

(3) A, C and D only

(4) A, B, D and E only

Answer: Option (2)


Question 15: Match List I with List II.

List I (Spectral Lines of Hydrogen for transitions from)List II (Wavelengths (nm))
A. \mathrm{n}_{2}=3 to \mathrm{n}_{1}=2I. 410.2
B. \mathrm{n}_{2}=4 to \mathrm{n}_{1}=2II. 434.1
C. \mathrm{n}_{2}=5 to \mathrm{n}_{1}=2III. 656.3
D. \mathrm{n}_{2}=6 to \mathrm{n}_{1}=2IV. 486.1

Choose the correct answer from the options given below:

(1) A-II, B-I, C-IV, D-III

(2) A-III, B-IV, C-II, D-I

(3) A-IV, B-III, C-I, D-II

(4) A-I, B-II, C-III, D-IV

Answer: Option (2)


Question 16: A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A . The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as 4 \pi \times 10^{-7} SI units) :

(1) 44 mT

(2) 4.4 T

(3) 4.4 mT

(4) 44 T

Answer: Option (3)


Question 17: The output (\mathrm{Y}) of the given logic gate is similar to

the output of an/a :

(1) NAND gate

(2) NOR gate

(3) OR gate

(4) AND gate

Answer: Option (4)


Question 18: A wire of length ‘ \ell ‘ and resistance 100 \Omega is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:(1) 26 \Omega

(2) 52 \Omega

(3) 55 \Omega

(4) 60 \Omega

Answer: Option (2)


Question 19: \quad{ }_{82}^{290} \mathrm{X} \xrightarrow{\alpha} \mathrm{Y} \xrightarrow{e^{+}} \mathrm{Z} \xrightarrow{\beta^{-}} \mathrm{P} \xrightarrow{e^{-}} \mathrm{Q} In the nuclear emission stated above, the mass number and atomic number of the product Q respectively, are :

(1) 280,81

(2) 286, 80

(3) 288,82

(4) 286,81

Answer: Option (4)


Question 20: The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young’s modulus, respectively, are 8 \times 10^{8} \mathrm{~N} \mathrm{~m}^{-2} and 2 \times 10^{11} \mathrm{~N} \mathrm{~m}^{-2} is :

(1) 4 mm

(2) 0.4 mm

(3) 40 mm

(4) 8 mm

Answer: Option (1)


Question: 21. If the monochromatic source in Young’s double slit experiment is replaced by white light, then

(1) interference pattern will disappear.

(2) there will be a central dark fringe surrounded by a few coloured fringes.

(3) there will be a central bright white fringe surrounded by a few coloured fringes.

(4) all bright fringes will be of equal width.

Answer: Option (3)


Question: 22. At any instant of time t, the displacement of any particle is given by 2 \mathrm{t}-1 (SI unit) under the influence of force of 5 N . The value of instantaneous power is (in SI unit) :

(1) 10

(2) 5

(3) 7

(4) 6

Answer: Option (1)


Question: 23. Consider the following statements A and B and identify the correct answer :

A. For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph.

B. In a reverse biased p n junction diode,

the current measured in (\mu A),

is due to majority charge carriers.

(1) A is correct but B is incorrect.

(2) A is incorrect but B is correct.

(3) Both A and B are correct.

(4) Both A and B are incorrect.

Answer: Option (1)


Question: 24. Two bodies A and B of same mass undergo completely inelastic one dimensional collision. The body A moves with velocity v_{1} while body B is at rest before collision. The velocity of the system after collision is v_{2}. The ratio v_{1}: v_{2} is :

(1) 1: 2

(2) 2: 1

(3) 4: 1

(4) 1: 4

Answer: Option (2)


Question: 25. A light ray enters through a right angled prism at point P with the angle of incidence 30^{\circ} as shown in figure. It travels through the prism parallel to its base BC and emerges along the face AC . The refractive index of the prism is :

(1) \frac{\sqrt{5}}{4}

(2) \frac{\sqrt{5}}{2}

(3) \frac{\sqrt{3}}{4}

(4) \frac{\sqrt{3}}{2}

Answer: Option (2)


Question: 26. The graph which shows the variation of \left(\frac{1}{\lambda^{2}}\right) and its kinetic energy, E is (where \lambda is de Broglie wavelength of a free particle) :

This image has an empty alt attribute; its file name is 2024-8.webp

Answer: Option (4)


Question: 27. The quantities which have the same dimensions as those of solid angle are :

(1) strain and angle

(2) stress and angle

(3) strain and arc

(4) angular speed and stress

Answer: Option (1)


Question: 28. An unpolarised light beam strikes a glass surface at Brewster’s angle Then

(1) the reflected light will be partially polarised.

(2) the refracted light will be completely polarised.

(3) both the reflected and refracted light will be completely polarised.

(4) the reflected light will be completely polarised but the refracted light will be partially polarised.

Answer: Option (4)


Question: 29. The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is 2400 \mathrm{~g} \mathrm{~cm}^{2}. The length of the 400 \mathrm{~g} \operatorname{rod} is nearly :

(1) 8.5 cm

(2) 17.5 cm

(3) 20.7 cm

(4) 72.0 cm

Answer: Option (1)


Question: 30. A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is 0.07 \mathrm{Nm}^{-1}, then the excess force required to take it away from the surface is :

(1) 19.8 mN

(2) 198 N

(3) 1.98 mN

(4) 99 N

Answer: Option (1)


Question: 31. A thermodynamic system is taken through the cycle abcda. The work done by the gas along the path bc is :

(1) zero

(2) 30 J

(3) -90 J

(4) -60 J

Answer: Option (1)


Question: 32. A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is v in the direction shown, which one of the following options is correct (P and Q are any highest and lowest points on the wheel, respectively) ?

(1) Point P moves slower than point Q .

(2) Point P moves faster than point Q.

(3) Both the points P and Q move with equal speed.

(4) Point P has zero speed.

Answer: Option (2)


Question: 33. The mass of a planet is \frac{1}{10} th that of the earth and its diameter is half that of the earth. The acceleration due to gravity on that planet is :

(1) 19.6 \mathrm{~m} \mathrm{~s}^{-2}

(2) 9.8 \mathrm{~m} \mathrm{~s}^{-2}

(3) 4.9 \mathrm{~m} \mathrm{~s}^{-2}

(4) 3.92 \mathrm{~m} \mathrm{~s}^{-2}

Answer: Option (4)


Question: 34. In the following circuit, the equivalent capacitance between terminal A and terminal B is :

(1) 2 \mu \mathrm{~F}

(2) 1 \mu \mathrm{~F}

(3) 0.5 \mu \mathrm{~F}

(4) 4 \mu \mathrm{~F}

Answer: Option (1)


Question: 35. A thin spherical shell is charged by some source. The potential difference between the two points C and P (in V) shown in the figure is :

(Take \frac{1}{4 \pi \epsilon_{0}}=9 \times 10^{9} SI units)

(1) 3 \times 10^{5}

(2) 1 \times 10^{5}

(3) 0.5 \times 10^{5}

(4) zero

Answer: Option (4)


Question: 36. The velocity (v) – time (t) plot of the motion of a body is shown below :

Answer: Option (3)


Question: 37. If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is \frac{x}{2} times its original time period. Then the value of x is :

(1) \sqrt{3}

(2) \sqrt{2}

(3) 2 \sqrt{3}

(4) 4

Answer: Option (2)


Question: 38. A 10 \mu \mathrm{~F} capacitor is connected to a 210 \mathrm{~V}, 50 \mathrm{~Hz} source as shown in figure. The peak current in the circuit is nearly ( \pi=3.14 ) :

(1) 0.58 A

(2) 0.93 A

(3) 1.20 A

(4) 0.35 A

Answer: Option (2)


Question: 39. The following graph represents the T-V curves of an ideal gas (where T is the temperature and V the volume) at three pressures \mathrm{P}_{1}, \mathrm{P}_{2} and \mathrm{P}_{3} compared with those of Charles’s law represented as dotted lines. Then the correct relation is :

(1) P_{3}>P_{2}>P_{1}

(2) P_{1}>P_{3}>P_{2}

(3) P_{2}>P_{1}>P_{3}

(4) P_{1}>P_{2}>P_{3}

Answer: Option (4)


Question: 40. An iron bar of length L has magnetic moment M. It is bent at the middle of its length such that the two arms make an angle 60^{\circ} with each other. The magnetic moment of this new magnet is: { }^{\circ}

(1) M

(2) \frac{\mathrm{M}}{2}

(3) 2 M

(4) \frac{\mathrm{M}}{\sqrt{3}}

Answer: Option (2)


Question: 41. The minimum energy required to launch a satellite of mass m from the surface of earth of mass M and radius R in a circular orbit at an altitude of 2R from the surface of the earth is :

(1) \frac{5 \mathrm{G} m M}{6 R}

(2) \frac{2 \mathrm{G} m M}{3 R}

(3) \frac{G m M}{2 R}

(4) \frac{\mathrm{G} m M}{3 R}

Answer: Option (1)


Question: 42. A parallel plate capacitor is charged by connecting it to a battery through a resistor. If I is the current in the circuit, then in the gap between the plates :

(1) there is no current.

(2) displacement current of magnitude equal to I flows in the same direction as I.

(3) displacement current of magnitude equal to I flows in a direction opposite to that of I.

(4) displacement current of magnitude greater than I flows but can be in any direction.

Answer: Option (2)


Question: 43. The property which is not of an electromagnetic wave travelling in free space is that:

(1) they are transverse in nature.

(2) the energy density in electric field is equal to energy density in magnetic field.

(3) they travel with a speed equal to \frac{1}{\sqrt{\mu_{0} \epsilon_{0}}}

(4) they originate from charges moving with uniform speed.

Answer: Option (4)


Question: 44. A metallic bar of Young’s modulus, 0.5 \times 10^{11} \mathrm{~N} \mathrm{~m}^{-2} and coefficient of linear thermal expansion 10^{-5}{ }^{\circ} \mathrm{C}^{-1}, length 1 m and area of cross-section 10^{-3} \mathrm{~m}^{2} is heated from 0^{\circ} \mathrm{C} to 100^{\circ} \mathrm{C} without expansion or bending. The compressive force developed in it is:

(1) 5 \times 10^{3} \mathrm{~N}

(2) 50 \times 10^{3} \mathrm{~N}

(3) 100 \times 10^{3} \mathrm{~N}

(4) 2 \times 10^{3} \mathrm{~N}

Answer: Option (2)


Question: 45. A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to :

A. hold the sheet there if it is magnetic.

B. hold the sheet there if it is non-magnetic.

C. move the sheet away from the pole with uniform velocity if it is conducting.

D. move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar. Choose the correct statement(s) from the options given below:

(1) B and D only

(2) A and C only

(3) A, C and D only

(4) C only

Answer: Option (2)


Question: 46. ‘Spin only’ magnetic moment is same for which of the following ions?

A. \mathrm{Ti}^{3+}

B. \mathrm{Cr}^{2+}

C. \mathrm{Mn}^{2+}

D. \mathrm{Fe} e^{2+}

E. \mathrm{Sc}^{3+}

Choose the most appropriate answer from the options given below :

(1) B and D only

(2) A and E only

(3) B and C only

(4) A and D only

Answer: Option (1)


Question: 47. The most stable carbocation among the following is :

Answer: Option (4)


Question: 48. Given below are two statements :

Statement-I : The boiling point of hydrides of Group-16 elements follow the order \mathrm{H}_{2} \mathrm{O}>\mathrm{H}_{2} \mathrm{Te}>\mathrm{H}_{2} \mathrm{Se}>\mathrm{H}_{2} \mathrm{~S}.

Statement-II : On the basis of molecular mass, \mathrm{H}_{2} \mathrm{O} is expected to have lower boiling point than the other members of the group but due to the presence of extensive H -bonding in \mathrm{H}_{2} \mathrm{O}, it has higher boiling point.

In the light of the above statements, choose the correct answer from the options given below :

(1) Both statement-I and Statement-II are true.

(2) Both statement-I and Statement-II are false.

(3) Statement-I is the true but Statement-II is false.

(4) Statement-I is false but Statement-II is true.

Answer: Option (1)


Question: 49. Match List I with List II.

List I (Compound)List II (Shape/geometry)
(A) \mathrm{NH}_{3}(I) Trigonal Pyramidal
(B) \mathrm{BrF}_{5}(II) Square Planar
(C) \mathrm{XeF}_{4}(III) Octahedral
(D) \mathrm{SF}_{6}(IV) Square Pyramidal

TEST PAPER WITH ANSWER

Choose the correct answer from the options given below:

(1) A-I, B-IV, C-II, D-III

(2) A-II, B-IV, C-III, D-I

(3) A-III, B-IV, C-I, D-II

(4) A-II, B-III, C-IV, D-I

Answer: Option (1)


Question: 50. The highest number of helium atoms is in :

(1) 4 mol of helium

(2) 4 u of helium

(3) 4 g of helium

(4) 2.271098 L of helium at STP

Answer: Option (1)


Question: 51. Identify the correct reagents that would bring about the following transformation

This image has an empty alt attribute; its file name is 2024-17.webp

(1) (i) \mathrm{H}_{2} \mathrm{O} / \mathrm{H}^{+} (ii) \mathrm{CrO}_{3}

(2) (i) \mathrm{BH}_{3} (ii) \mathrm{H}_{2} \mathrm{O}_{2} / \stackrel{\ominus}{\mathrm{O}} \mathrm{H} (iii) PCC

(3) (i) \mathrm{BH}_{3} (ii) \mathrm{H}_{2} \mathrm{O}_{2} / \stackrel{\ominus}{\mathrm{O}} \mathrm{H} (iii) Alk. \mathrm{KMnO}_{4} (iv) \mathrm{H}_{3} \mathrm{O}^{\oplus}

(4) (i) \mathrm{H}_{2} \mathrm{O} / \mathrm{H}^{+} (ii) PCC

Answer: Option (2)


Question: 52. Match List I with List II.

List-I (Process)List-II (Conditions)
A. Isothermal processI. No heat exchange
B. Isochoric processII. Carried out at constant temperature
C. Isobaric processIII. Carried out at constant volume
D. Adiabatic processIV. Carried out at constant pressure

Choose the correct answer from the options given below :

(1) A-IV, B-III, C-II, D-I

(2) A-IV, B-II, C-III, D-I

(3) A-I, B-II, C-III, D-IV

(4) A-II, B-III, C-IV, D-I

Answer: Option (4)


Question: 53. Which one one of the following alcohols reacts instantaneously with Lucas reagent?

(1) \mathrm{CH}_{3}-\mathrm{CH}_{2}-\mathrm{CH}_{2}-\mathrm{CH}_{2} \mathrm{OH}

(2) CCC(C)O

(3) CC(C)CO

(4) CC(C)(C)O

Answer: Option (4)


Question: 54. In which of the following equilibria, \mathrm{K}_{\mathrm{p}} and \mathrm{K}_{\mathrm{c}} are NOT equal ?

(1) \mathrm{PCl}_{5(\mathrm{~g})} \rightleftharpoons \mathrm{PCl}_{3(\mathrm{~g})}+\mathrm{Cl}_{2(\mathrm{~g})}

(2) \mathrm{H}_{2(\mathrm{~g})}+\mathrm{I}_{2(\mathrm{~g})} \rightleftharpoons 2 \mathrm{HI}_{(\mathrm{g})}

(3) \mathrm{CO}_{(\mathrm{g})}+\mathrm{H}_{2} \mathrm{O}_{(\mathrm{g})} \rightleftharpoons \mathrm{CO}_{2(\mathrm{~g})}+\mathrm{H}_{2(\mathrm{~g})}

(4) 2 \mathrm{BrCl}_{(\mathrm{g})} \rightleftharpoons \mathrm{Br}_{2(\mathrm{~g})}+\mathrm{Cl}_{2(\mathrm{~g})}

Answer: Option (1)


Question: 55. Match List I with List II.

List I (Quantum Number)List II (Information provided)
A. m_{\ell}I. shape of orbital
B. m_{s}II. size of orbital
C. \ellIII. orientation of orbital
D. nIV. orientation of spin of electron

Choose the correct answer from the options given below:

(1) A-I, B-III, C-II, D-IV

(2) A-III, B-IV, C-I, D-II

(3) A-III, B-IV, C-II, D-I

(4) A-II, B-I, C-IV, D-III

Answer: Option (2)


Question: 56. Given below are two statements :

Statement I : Aniline does not undergo FriedelCrafts alkylation reaction

Statement II : Aniline cannot be prepared through Gabriel synthesis.

In the light of the above statements, choose the correct answer from the options given below :

(1) Both Statement I and Statement II are true.

(2) Both Statement I and Statement II are false.

(3) Statement I is correct but Statement II is false.

(4) Statement I is incorrect but Statement II is true.

Answer: Option (1)


Question: 57. Intramolecular hydrogen bonding is present in :

::contentReference[oaicite:0]{index=0}

Answer: Option (1)


Question: 58. On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as :

(1) Crystallization

(2) Sublimation

(3) Distillation

(4) Chromatography

Answer: Option (2)


Question: 59. In which of the following processes entropy increases?

A. A liquid evaporates to vapour

B. Temperature of a crystalline solid lowered from 130 K to 0K.

C. 2 \mathrm{NaHCO}_{3(\mathrm{~s})} \rightarrow \mathrm{Na}_{2} \mathrm{CO}_{3(\mathrm{~s})}+\mathrm{CO}_{2(\mathrm{~g})}+\mathrm{H}_{2} \mathrm{O}_{(\mathrm{g})}

D. \mathrm{Cl}_{2(\mathrm{~g})} \rightarrow 2 \mathrm{Cl}_{(\mathrm{g})}

Choose the correct answer from the options given below :

(1) A and C

(2) A, B and D

(3) A, C and D

(4) C and D

Answer: Option (3)


Question: 60. Among Group 16 elements, which one does NOT show -2 oxidation state?

(1) O

(2) Se

(3) Te

(4) Po

Answer: Option (4)


Question: 61. Match List-I with List-II.

List-I (Conversion)List-II (Number of Faraday required)
(A) 1 mol of \mathrm{H}_{2} \mathrm{O} to \mathrm{O}_{2}(I) 3 F
(B) 1 mol of \mathrm{MnO}_{4}^{-} to \mathrm{Mn}^{2+}(II) 2 F
(C) 1.5 mole of Ca from molten \mathrm{CaCl}_{2}(III) 1 F
(D) 1 mol of FeO to \mathrm{Fe}_{2} \mathrm{O}_{3}(IV) 5 F

(1) A-II, B-IV, C-I, D-III

(2) A-III, B-IV, C-I, D-II

(3) A-II, B-III, C-I, D-IV

(4) A-III, B-IV, C-II, D-I

Answer: Option (1)


Question: 62. Arrange the following elements in increasing order of electronegativity.

N, O, F, C, Si

Choose the correct answer from the options given below:

(1) Si < C < N < O < F

(2) Si < C < O < N < F

(3) O < F < N < C < Si

(4) F < O < N < C < Si

Answer: Option (1)


Question: 63. A compound with a molecular formula of \mathrm{C}_{6} \mathrm{H}_{14} has two tertiary carbons. Its IUPAC name is :

(1) n-hexane

(2) 2-methylpentane

(3) 2, 3-dimethylbutane

(4) 2, 2-dimethylbutane

Answer: Option (3)


Question: 64. Fehling’s solution ‘A’ is

(1) aqueous copper sulphate

(2) alkaline copper sulphate

(3) alkaline solution of sodium potassium tartrate (Rochelle’s salt)

(4) aqueous sodium citrate

Answer: Option (1)


Question: 65. Activation energy of any chemical reaction can be calculated if one knows the value of

(1) rate constant at standard temperature.

(2) probability of collision.

(3) orientation of reactant molecules during collision.

(4) rate constant at two different temperatures.

Answer: Option (4)


Question: 66. Which plot of \ln k vs \frac{1}{T} is consistent with Arrhenius equation?

Answer: Option (4)


Question: 67. Match List I with List II. Choose the correct answer from the options given below :

This image has an empty alt attribute; its file name is 2024-20.webp

(1) A-IV, B-I, C-III, D-II

(2) A-III, B-I, C-II, D-IV

(3) A-IV, B-I, C-II, D-III

(4) A-I, B-IV, C-II, D-III

Answer: Option (3)


Question: 68. The compound that will undergo \mathrm{S}_{\mathrm{N}}{ }^{1} reaction with the fastest rate is :

::contentReference[oaicite:0]{index=0}

This image has an empty alt attribute; its file name is 2024-21.webp

Answer: Option (4)


Question: 69. Which reaction is NOT a redox reaction?

(1) \mathrm{Zn}+\mathrm{CuSO}_{4} \rightarrow \mathrm{ZnSO}_{4}+\mathrm{Cu}

(2) 2 \mathrm{KClO}_{3}+\mathrm{I}_{2} \rightarrow 2 \mathrm{KIO}_{3}+\mathrm{Cl}_{2}

(3) \mathrm{H}_{2}+\mathrm{Cl}_{2} \rightarrow 2 \mathrm{HCl}

(4) \mathrm{BaCl}_{2}+\mathrm{Na}_{2} \mathrm{SO}_{4} \rightarrow \mathrm{BaSO}_{4}+2 \mathrm{NaCl}

Answer: Option (4)


Question: 70. Given below are two statements :

Statement I: The boiling point of three isomeric pentanes follows the order n-pentane > isopentane > neopentane

Statement II : When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point.

In the light of the above statements, choose the most appropriate answer from the options given below:

(1) Both statement I and Statement II are correct

(2) Both Statement I and Statement II are incorrect

(3) Statement I is correct but Statement II is incorrect

(4) Statement I is incorrect but Statement II is correct

Answer: Option (1)


Question: 71. Given below are two statements :

Statement I : Both \left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{6}\right]^{+3} and \left[\mathrm{CoF}_{6}\right]^{3-} complexes are octahedral but differ in their magnetic behaviour.

Statement II : \left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{6}\right]^{3+} is diamagnetic whereas \left[\mathrm{CoF}_{6}\right]^{3-} is paramagnetic.

In the light of the above statements, choose the correct answer from the options given below :

(1) Both statement I and Statement II are true

(2) Both Statement I and Statement II are false

(3) Statement I is true but Statement II is false

(4) Statement I is false but Statement II is true

Answer: Option (1)


Question: 72. Match List I with List II.

List-I
(Molecule)
List-II
(Number and type of bond/s between two carbon atoms)
A. ethaneI. one \sigma-bond and two \pi-bonds
B. etheneII. two \pi-bonds
C. carbon molecule, \mathrm{C}_{2}III. one \sigma-bond
D. ethyneIV. one \sigma-bond and one \pi-bond

Choose the correct answer from the options given below:

(1) A-I, B-IV, C-II, D-III

(2) A-IV, B-III, C-II, D-I

(3) A-III, B-IV, C-II, D-I

(4) A-III, B-IV, C-I, D-II

Answer: Option (3)


Question: 73. The Henry’s law constant \left(\mathrm{K}_{\mathrm{H}}\right) values of three gases (A, B, C) in water are 145, 2 \times 10^{-5} and 35 kbar, respectively. The solubility of these gases in water follow the order :

(1) \mathrm{B}>\mathrm{A}>\mathrm{C}

(2) \mathrm{B}>\mathrm{C}>\mathrm{A}

(3) \mathrm{A}>\mathrm{C}>\mathrm{B}

(4) \mathrm{A}>\mathrm{B}>\mathrm{C}

Answer: Option (2)


Question: 74. The energy of an electron in the ground state ( \mathrm{n}=1 ) for \mathrm{He}^{+} ion is -xJ , then that for an electron in \mathrm{n}=2 state for \mathrm{Be}^{3+} ion in J is:

(1) -x

(2) -\frac{x}{9}

(3) -4x

(4) -\frac{4}{9}x

Answer: Option (1)


Question: 75. The \mathrm{E}^{\circ} value for the \mathrm{Mn}^{3+} / \mathrm{Mn}^{2+} couple is more positive than that of \mathrm{Cr}^{3+} / \mathrm{Cr}^{2+} or \mathrm{Fe}^{3+} / \mathrm{Fe}^{2+} due to change of

(1) \mathrm{d}^{5} to \mathrm{d}^{4} configuration

(2) d^{5} to d^{2} configuration

(3) d^{4} to d^{5} configuration

(4) d^{3} to d^{5} configuration

Answer: Option (3)


Question: 76. The reagents with which glucose does not react to give the corresponding tests/products are

A. Tollen’s reagent

B. Schiff’s reagent

C. HCN

D. \mathrm{NH}_{2} \mathrm{OH}

E. \mathrm{NaHSO}_{3}

Choose the correct options from the given below :

(1) B and C

(2) A and D

(3) B and E

(4) E and D

Answer: Option (3)


Question: 77. Match List I with List II.

List-I (Complex)List-II (Type of isomerism)
A. \left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{5}\left(\mathrm{NO}_{2}\right)\right] \mathrm{Cl}_{2}I. Solvate isomerism
B. \left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{5}\left(\mathrm{SO}_{4}\right)\right] \mathrm{Br}II. Linkage isomerism
C. \left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{6}\right]\left[\mathrm{Cr}(\mathrm{CN})_{6}\right]III. Ionization isomerism
D. \left[\mathrm{Co}\left(\mathrm{H}_{2} \mathrm{O}\right)_{6}\right] \mathrm{Cl}_{3}IV. Coordination isomerism

Choose the correct answer from the options given below:

(1) A-II, B-III, C-IV, D-I

(2) A-I, B-III, C-IV, D-II

(3) A-I, B-IV, C-III, D-II

(4) A-II, B-IV, C-III, D-I

Answer: Option (1)


Question: 78. Arrange the following elements in increasing order of first ionization enthalpy:

Li, Be, B, C, N

Choose the correct answer from the options given below:

(1) Li < Be < B < C < N

(2) Li < B < Be < C < N

(3) Li < Be < C < B < N

(4) Li < Be < N < B < C

Answer: Option (2)


Question: 79. 1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCL solution, the mass of sodium hydroxide left unreacted is equal to

(1) 750 mg

(2) 250 mg

(3) Zero mg

(4) 200 mg

Answer: Option (2)


Question: 80. For the reaction 2 \mathrm{~A} \rightleftharpoons \mathrm{~B}+\mathrm{C}, \mathrm{K}_{\mathrm{c}}=4 \times 10^{-3}. At a given time, the composition of reaction mixture is: [\mathrm{A}]=[\mathrm{B}]=[\mathrm{C}]=2 \times 10^{-3} \mathrm{M}.

Then, which of the following is correct?

(1) Reaction is at equilibrium.

(2) Reaction has a tendency to go in forward direction.

(3) Reaction has a tendency to go in backward direction

(4) Reaction has gone to completion in forward direction.

Answer: Option (3)


Question: 81. Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI.

A. \mathrm{Al}^{3+}

B. \mathrm{Cu}^{2+}

C. \mathrm{Ba}^{2+}

D. \mathrm{Co}^{2+}

E. \mathrm{Mg}^{2+}

Choose the correct answer from the options given below:

(1) B, A, D, C, E

(2) \mathrm{B}, \mathrm{C}, \mathrm{A}, \mathrm{D}, \mathrm{E}

(3) \mathrm{E}, \mathrm{C}, \mathrm{D}, \mathrm{B}, \mathrm{A}

(4) \mathrm{E}, \mathrm{A}, \mathrm{B}, \mathrm{C}, \mathrm{D}

Answer: Option (1)


Question: 82. The products A and B obtained in the following reactions, respectively, are

3 \mathrm{ROH}+\mathrm{PCl}_{3} \rightarrow 3 \mathrm{RCl}+\mathrm{A} \mathrm{ROH}+\mathrm{PCl}_{5} \rightarrow \mathrm{RCl}+\mathrm{HCl}+\mathrm{B}

(1) \mathrm{POCl}_{3} and \mathrm{H}_{3} \mathrm{PO}_{3}

(2) \mathrm{POCl}_{3} and \mathrm{H}_{3} \mathrm{PO}_{4}

(3) \mathrm{H}_{3} \mathrm{PO}_{4} and \mathrm{POCl}_{3}

(4) \mathrm{H}_{3} \mathrm{PO}_{3} and \mathrm{POCl}_{3}

Answer: Option (4)


Question: 83. Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 100 seconds is:

(Given : Molar mass of \mathrm{Cu}: 63 \mathrm{~g} \mathrm{~mol}^{-1}, 1 \mathrm{~F}=96487 \mathrm{C} )

(1) 3.15 g

(2) 0.315 g

(3) 31.5 g

(4) 0.0315 g

Answer: Option (2)


Question: 84. The plot of osmotic pressure ( \Pi ) vs concentration (mol \mathrm{L}^{-1} ) for a solution gives a straight line with slope 25.73 \mathrm{~L}^{-1} bar \mathrm{mol}^{-1}. The temperature at which the osmotic pressure measurement is done is:

(Use \mathrm{R}=0.083 \mathrm{~L} bar \mathrm{mol}^{-1} \mathrm{~K}^{-1} )

(1) 37^{\circ} \mathrm{C}

(2) 310^{\circ} \mathrm{C}

(3) 25.73^{\circ} \mathrm{C}

(4) 12.05^{\circ} \mathrm{C}

Answer: Option (1)


Question: 85. Identify the major product C formed in the following reaction sequence:

\mathrm{CH}_{3}-\mathrm{CH}_{2}-\mathrm{CH}_{2}-\mathrm{I} \xrightarrow{\mathrm{NaCN}} \mathrm{A} \xrightarrow[\text { Partial hydrolysis }]{\mathrm{OH}^{-}} \mathrm{B} \xrightarrow[\mathrm{Br}_{2}]{\mathrm{NaOH}} \underset{\text { (Major) }}{\mathrm{C}}

(1) propylamine

(2) butylamine

(3) butanamide

(4) \alpha – bromobutanoic acid

Answer: Option (1)


Question: 86. Identify the correct answer.

(1) Three resonance structures can be drawn for ozone

(2) \mathrm{BF}_{3} has non-zero dipole moment

(3) Dipole moment of \mathrm{NF}_{3} is greater than that of \mathrm{NH}_{3}

(4) Three canonical forms can be drawn for \mathrm{CO}_{3}^{2-} ion.

Answer: Option (4)


Question: 87. Given below are two statements:

Statement I : \left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{6}\right]^{3+} is a homoleptic complex whereas \left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{4} \mathrm{Cl}_{2}\right]^{+}is a heteroleptic complex.

Statement II : Complex \left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{6}\right]^{3+} has only one kind of ligands but \left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{4} \mathrm{Cl}_{2}\right]^{+} has more than one kind of ligands.

In the light of the above statements, choose the correct answer from the options given below.

(1) Both Statement I and Statement II are true.

(2) Both Statement I and Statement II are false.

(3) Statement I is true but Statement II is false.

(4) Statement I is false but Statement II is true.

Answer: Option (1)


Question: 88. The pair of lanthanoid ions which are diamagnetic is

(1) \mathrm{Ce}^{4+} and \mathrm{Yb}^{2+}

(2) \mathrm{Ce}^{3+} and \mathrm{Eu}^{2+}

(3) \mathrm{Gd}^{3+} and \mathrm{Eu}^{3+}

(4) \mathrm{Pm}^{3+} and \mathrm{Sm}^{3+}

Answer: Option (1)


Question: 89. Consider the following reaction in a sealed vessel at equilibrium with concentrations of

\mathrm{N}_{2}=3.0 \times 10^{-3} \mathrm{M}, \mathrm{O}_{2}=4.2 \times 10^{-3} \mathrm{M} and

\mathrm{NO}=2.8 \times 10^{-3} \mathrm{M}.

2 \mathrm{NO}_{(\mathrm{g})} \rightleftharpoons \mathrm{N}_{2(\mathrm{~g})}+\mathrm{O}_{2(\mathrm{~g})}

If 0.1 \mathrm{~mol} \mathrm{~L}^{-1} of \mathrm{NO}_{(\mathrm{g})}

is taken in a closed vessel, what will be degree of dissociation

( \alpha ) of \mathrm{NO}_{(\mathrm{g})} at equilibrium?

(1) 0.00889

(2) 0.0889

(3) 0.8889

(4) 0.717

Answer: Option (4)


Question: 90. A compound X contains 32 \% of \mathrm{A}, 20 \% of B and remaining percentage of C. Then, the empirical formula of X is :

(Given atomic masses of \mathrm{A}=64 ; \mathrm{B}=40 ; \mathrm{C}=32 \mathrm{u} )

(1) A_{2} B C_{2}

(2) \mathrm{ABC}_{3}

(3) \mathrm{AB}_{2} \mathrm{C}_{2}

(4) \mathrm{ABC}_{4}

Answer: Option (2)


Question: 91. Lecithin, a small molecular weight organic compound found in living tissues,

is an example of :

(1) Amino acids

(2) Phospholipids

(3) Glycerides

(4) Carbohydrates

Answer: Option (2)


Question: 92. Which of the following are required for the dark reaction of photosynthesis?

A. Light

B. Chlorophyll

C. \mathrm{CO}_{2}

D. ATP

E. NADPH

Choose the correct answers from the options given below:

(1) A, B and C only

(2) B, C and D only

(3) C, D and E only

(4) D and E only

Answer: Option (3)


Question: 93. Spindle fibers attach to kinetochores of chromosomes during

(1) Prophase

(2) Metaphase

(3) Anaphase

(4) Telophase

Answer: Option (2)


Question: 94. Bulliform cells are responsible for

(1) Inward curling of leaves in monocots.

(2) Protecting the plant from salt stress.

(3) Increased photosynthesis in monocots.

(4) Providing large spaces for storage of sugars.

Answer: Option (1)


Question: 95. In the given figure, which component has thin outer walls and highly thickened inner walls?

(1) C

(2) D

(3) A

(4) B

Answer: Option (1)


Question: 96. What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism?

A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.

B. It may get integrated into the genome of the recipient.

C. It may multiply and be inherited along with the host DNA.

D. The alien piece of DNA is not an integral part of chromosome.

E. It shows ability to replicate.

Choose the correct answer from the options given below:

(1) A and B only

(2) D and E only

(3) B and C only

(4) A and E only

Answer: Option (3)


Question: 97. Given below are two statements:

Statement I : Bt toxins are insect group specific and coded by a gene cry IAc.

Statement II : Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic pH of the insect gut.

In the light of the above statements, choose the correct answer from the options given below:

(1) Both Statement I and Statement II are true

(2) Both Statement I and Statement II are false

(3) Statement I is true but Statement II is false

(4) Statement I is false but Statement II is true

Answer: Option (3)


Question: 98. List of endangered species was released by-

(1) GEAC

(2) WWF

(3) FOAM

(4) IUCN

Answer: Option (4)


Question: 99. Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

(1) A

(2) B

(3) C

(4) D

Answer: Option (3)


Question: 100. Match List I with List II.

List IList II
A. Clostridium butylicumI. Ethanol
B. Saccharomyces cerevisiaeII. Streptokinase
C. Trichoderma polysporumIII. Butyric acid
D. Streptococcus sp .IV. Cyclosporin-A

Choose the correct answer from the options given below:

(1) A-III, B-I, C-II, D-IV

(2) A-II, B-IV, C-III, D-I

(3) A-III, B-I, C-IV, D-II

(4) A-IV, B-I, C-III, D-II

Answer: Option (3)


Question: 101. Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b).

This image has an empty alt attribute; its file name is 2024-24.webp

(1) (a) Epigynous; (b) Hypogynous

(2) (a) Hypogynous; (b) Epigynous

(3) (a) Perigynous; (b) Epigynous

(4) (a) Perigynous; (b) Perigynous

Answer: Option (4)


Question: 102. Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin

(1) promotes apical dominance.

(2) promotes abscission of mature leaves only.

(3) does not affect mature monocotyledonous plants.

(4) can help in cell division in grasses, to produce growth.

Answer: Option (3)


Question: 103. A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

(1) Only red flowered plants

(2) Red flowered as well as pink flowered plants

(3) Only pink flowered plants

(4) Red, Pink as well as white flowered plants

Answer: Option (2)


Question: 104. Which one of the following is not a criterion for classification of fungi?

(1) Morphology of mycelium

(2) Mode of nutrition

(3) Mode of spore formation

(4) Fruiting body

Answer: Option (2)


Question: 105. The lactose present in the growth medium of bacteria is transported to the cell by the action of:

(1) Beta-galactosidase

(2) Acetylase

(3) Permease

(4) Polymerase

Answer: Option (3)


Question: 106. In a plant, black seed color ( \mathrm{BB} / \mathrm{Bb} ) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

(1) BB

(2) bb

(3) Bb

(4) \mathrm{BB} / \mathrm{Bb}

Answer: Option (2)


Question: 107. Given below are two statements:

Statement I : Parenchyma is living but collenchyma is dead tissue.

Statement II : Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms.

In the light of the above statements, choose the correct answer from the options given below:

(1) Both Statement I and Statement II are true

(2) Both Statement I and Statement II are false

(3) Statement I is true but Statement II is false

(4) Statement I is false but Statement II is true

Answer: Option (4)


Question: 108. How many molecules of ATP and NADPH are required for every molecule of \mathrm{CO}_{2} fixed in the Calvin cycle?

(1) 2 molecules of ATP and 3 molecules of NADPH.

(2) 2 molecules of ATP and 2 molecules of NADPH.

(3) 3 molecules of ATP and 3 molecules of NADPH.

(4) 3 molecules of ATP and 2 molecules of NADPH.

Answer: Option (4)


Question: 109. A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

(1) Repressor, Operator gene, Structural gene

(2) Structural gene, Transposons, Operator gene

(3) Inducer, Repressor, Structural gene

(4) Promotor, Structural gene, Terminator

Answer: Option (4)


Question: 110. Tropical regions show greatest level of species richness because

A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification.

B. Tropical environments are more seasonal.

C. More solar energy is available in tropics.

D. Constant environments promote niche specialization.

E. Tropical environments are constant and predictable.

Choose the correct answer from the options given below:

(1) A, C, D and E only

(2) A and B only

(3) A, B and E only

(4) A, B and D only

Answer: Option (1)


Question: 111. The equation of Verhulst-Pearl logistic growth is \frac{d N}{d t}=r N\left[\frac{K-N}{K}\right]

From this equation, K indicates :

(1) Intrinsic rate of natural increase

(2) Biotic potential

(3) Carrying capacity

(4) Population density

Answer: Option (3)


Question: 112. Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of :

(2) Feedback inhibition

(1) Cofactor inhibition

(3) Competitive inhibition

(4) Enzyme activation

Answer: Option (3)


Question: 113. Which one of the following can be explained on the basis of Mendel’s Law of Dominance?

A. Out of one pair of factors one is dominant and the other is recessive.

B. Alleles do not show any expression and both the characters appear as such in \mathrm{F}_{2} generation.

C. Factors occur in pairs in normal diploid plants.

D. The discrete unit controlling a particular character is called factor.

E. The expression of only one of the parental characters is found in a monohybrid cross.

Choose the correct answer from the options given below:

(1) A, B and C only

(2) A, C, D and E only

(3) B, C and D only

(4) A, B, C, D and E

Answer: Option (2)


Question: 114. Match List I with List II

List IList II
A. NucleolusI. Site of formation of glycolipid
B. CentrioleII. Organization like the cartwheel
C. LeucoplastsIII. Site for active ribosomal RNA synthesis
D. Golgi apparatusIV. For storing nutrients

Choose the correct answer from the options given below:

(1) A-III, B-II, C-IV, D-I

(2) A-II, B-III, C-I, D-IV

(3) A-III, B-IV, C-II, D-I

(4) A-I, B-II, C-III, D-IV

Answer: Option (1)


Question: 115. Identify the set of correct statements:

A. The flowers of Vallisneria are colourful and produce nectar.

B. The flowers of waterlily are not pollinated by water.

C. In most of water-pollinated species, the pollen grains are protected from wetting.

D. Pollen grains of some hydrophytes are long and ribbon like.

E. In some hydrophytes, the pollen grains are carried passively inside water.

Choose the correct answer from the options given below :

(1) C, D and E only

(2) A, B, C and D only

(3) A, C, D and E only

(4) B, C, D and E only

Answer: Option (4)


Question: 116. Match List-I with List-II

List-IList-II
A. RhizopusI. Mushroom
B. UstilagoII. Smut fungus
C. PucciniaIII. Bread mould
D. AgaricusIV. Rust fungus

Choose the correct answer from the options given below :

(1) A-III, B-II, C-IV, D-I

(2) A-I, B-III, C-II, D-IV

(3) A-III, B-II, C-I, D-IV

(4) A-IV, B-III, C-II, D-I

Answer: Option (1)


Question: 117. Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of :

(1) 8 bp

(2) 6 bp

(3) 4 bp

(4) 10 bp

Answer: Option (2)


Question: 118. Which of the following is an example of actinomorphic flower?

(1) Datura

(2) Cassia

(3) Pisum

(4) Sesbania

Answer: Option (1)


Question: 119. The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called ;

(1) in-situ conservation

(2) Biodiversity conservation

(3) Semi-conservative method

(4) Sustainable development

Answer: Option (2)


Question: 120. Given below are two statements:

Statement-I : Chromosomes become gradually visible under light microscope during leptotene stage.

Statement-II : The begining of diplotene stage is recognized by dissolution of synaptonemal complex. In the light of the above statements, choose the correct answer from the options given below :

(1) Both Statement-I and Statement-II are true

(2) Both Statement-I and Statement-II are false

(3) Statement-I is true but Statement-II is false

(4) Statement-I is false but Statement-II is true

Answer: Option (1)


Question: 121. Formation of interfascicular cambium from fully developed parenchyma cells is an example for

(1) Differentiation

(2) Redifferentiation

(3) Dedifferentiation

(4) Maturation

Answer: Option (3)


Question: 122. The capacity to generate a whole plant from any cell of the plant is called :

(1) Totipotency

(2) Micropropagation

(3) Differentiation

(4) Somatic hybridization

Answer: Option (1)


Question: 123. The cofactor of the enzyme carboxypeptidase is :

(1) Zinc

(2) Niacin

(3) Flavin

(4) Haem

Answer: Option (1)


Question: 124. These are regarded as major causes of biodiversity loss :

A. Over exploitation

B. Co-extinction

C. Mutation

D. Habitat loss and fragmentation

E. Migration

Choose the correct option :

(1) A, C and D only

(2) A, B, C and D only

(3) A, B and E only

(4) A, B and D only

Answer: Option (4)


Question: 125. Match List I with List II

List I(Types of Stamens)List II(Example)
A. MonoadelphousI. Citrus
B. DiadelphousII. Pea
C. PolyadelphousIII. Lily
D. EpiphyllousIV. China-rose

Choose the correct answer from the options given below:

(1) A-IV, B-II, C-I, D-III

(2) A-IV, B-I, C-II, D-III

(3) A-I, B-II, C-IV, D-III

(4) A-III, B-I, C-IV, D-II

Answer: Option (1)


Question: 126. Match List I with List II

List IList II
A. GLUT-4I. Hormone
B. InsulinII. Enzyme
C. TrypsinIII. Intercellular ground substance
D. CollagenIV. Enables glucose transport into cells

Choose the correct answer from the options given below:

(1) A-IV, B-I, C-II, D-III

(2) A-I, B-II, C-III, D-IV

(3) A-II, B-III, C-IV, D-I

(4) A-III, B-IV, C-I, D-II

Answer: Option (1)


Question: 127. Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.

(1) Malic acid → Oxaloacetic acid

(2) Succinic acid → Malic acid

(3) Succinyl-CoA → Succinic acid

(4) Isocitrate \rightarrow \alpha-ketoglutaric acid

Answer: Option (3)


Question: 128. Match List I with List II

List IList II
A. Citric acid cycleI. Cytoplasm
B. GlycolysisII. Mitochondrial matrix
C. Electron transport systemIII. Intermembrane space of mitochondria
IV. Inner mitochondrial membrane

Choose the correct answer from the options given below:

(1) A-I, B-II, C-III, D-IV

(2) A-II, B-I, C-IV, D-III

(3) A-III, B-IV, C-I, D-II

(4) A-IV, B-III, C-II, D-I

Answer: Option (2)


Question: 129. Match List I with List II

List IList II
A. Frederick GriffithI. Genetic code
B. Francois Jacob & Jacque MonodII. Semi-conservative mode of DNA replication
C. Har Gobind KhoranaIII. Transformation
D. Meselson & StahlIV. Lac operon

Choose the correct answer from the options given below:

(1) A-III, B-II, C-I, D-IV

(2) A-III, B-IV, C-I, D-II

(3) A-II, B-III, C-IV, D-I

(4) A-IV, B-I, C-II, D-III

Answer: Option (2)


Question: 130. Given below are two statements:

Statement I: In \mathrm{C}_{3} plants, some \mathrm{O}_{2} binds to RuBisCO, hence \mathrm{CO}_{2} fixation is decreased.

Statement II : In \mathrm{C}_{4} plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.

In the light of the above statements, choose the correct answer from the options given below :

(1) Both Statement I and Statement II are true

(2) Both Statement I and Statement II are false

(3) Statement I is true but Statement II is false

(4) Statement I is false but Statement II is true

Answer: Option (3)


Question: 131. Identify the correct description about the given figure :

(1) Wind pollinated plant inflorescence showing flowers with well exposed stamens.

(2) Water pollinated flowers showing stamens with mucilaginous covering.

(3) Cleistogamous flowers showing autogamy

(4) Compact inflorescence showing complete

Answer: Option (1)


Question: 132. Match List I with List II

List IList II
A. RoseI. Twisted aestivation
B. PeaII. Perigynous flower
C. CottonIII. Drupe
D. MangoIV. Marginal placentation

Choose the correct answer from the options given below:

(1) A-II, B-IV, C-I, D-III

(2) A-I, B-II, C-III, D-IV

(3) A-IV, B-III, C-II, D-I

(4) A-II, B-III, C-IV, D-I

Answer: Option (1)


Question: 133. Read the following statements and choose the set of correct statements :

In the members of Phaeophyceae,

A. Asexual reproduction occurs usually by biflagellate zoospores.

B. Sexual reproduction is by oogamous method only.

C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.

D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.

E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin.

Choose the correct answer from the options given below:

(1) A, B, C and D only

(2) B, C, D and E only

(3) A, C, D and E only

(4) A, B, C and E only

Answer: Option (3)


Question: 134. In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100 \times\left(\mathrm{kcal} \mathrm{m}^{-2}\right) \mathrm{yr}^{-1}, what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem ?

(1) \frac{X}{10}\left(\mathrm{kcal} \mathrm{m}^{-2}\right) \mathrm{yr}^{-1}

(2) \mathrm{x}\left(\mathrm{kcal} \mathrm{m}^{-2}\right) \mathrm{yr}^{-1}

(3) 10 x\left(\mathrm{kcal} \mathrm{m}^{-2}\right) \mathrm{yr}^{-1}

(4) \frac{100 x}{3 x}\left(\mathrm{kcal} \mathrm{m}^{-2}\right) \mathrm{yr}^{-1}

Answer: Option (3)


Question: 135. Which of the following statement is correct regarding the process of replication in E.coli?

(1) The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3^{\prime} \rightarrow 5^{\prime}

(2) The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5^{\prime} \rightarrow 3^{\prime}

(3) The DNA dependent DNA polymerase catalyses polymerization in 5^{\prime} \rightarrow 3^{\prime} as well as 3^{\prime} \rightarrow 5^{\prime} direction

(4) The DNA dependent DNA polymerase catalyses polymerization in 5^{\prime} \rightarrow 3^{\prime} direction.

Answer: Option (4)


Question: 136. Which of the following are fused in somatic hybridization involving two varieties of plants?

(1) Callus

(2) Somatic embryos

(3) Protoplasts

(4) Pollens

Answer: Option (3)


Question: 137. Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?

(1) Auxin

(2) Gibberellin

(3) Cytokinin

(4) Abscisic acid

Answer: Option (2)


Question: 138. Match List I with List II

List IList II
A. Robert MayI. Species-Area relationship
B. Alexander II. von HumboldtII. Long term ecosystem experiment using out door plots
C. Paul EhrlichIII. Global species diversity at about 7 million
D. David TilmanIV. Rivet popper hypothesis

Choose the correct answer from the options given below:

(1) A-II, B-III, C-I, D-IV

(2) A-III, B-I, C-IV, D-II

(3) A-I, B-III, C-II, D-IV

(4) A-III, B-IV, C-II, D-I

Answer: Option (2)


Question: 139. The DNA present in chloroplast is :

(1) Linear, double stranded

(2) Circular, double stranded

(3) Linear, single stranded

(4) Circular, single stranded

Answer: Option (2)


Question: 140. Match List I with List II :

List IList II
A. Common coldI. Plasmodium
B. HaemozoinII. Typhoid
C. Widal testIII. Rhinoviruses
D. AllergyIV. Dust mites

Choose the correct answer from the options given below:

(1) A-II, B-IV, C-III, D-I

(2) A-I, B-III, C-II, D-IV

(3) A-III, B-I, C-II, D-IV

(4) A-IV, B-II, C-III, D-I

Answer: Option (3)


Question: 141. Match List I with List II :

List IList II
A. CocaineI. Sedative in surgery
B. HeroinII. Cannabis sativa
C. MorphineIII. Erythroxylum
D. MarijuanaIV. Papaver somniferum

Choose the correct answer from the options given below:

(1) A-IV, B-III, C-I, D-II

(2) A-I, B-III, C-II, D-IV

(3) A-II, B-I, C-III, D-IV

(4) A-III, B-IV, C-I, D-II

Answer: Option (4)


Question: 142. Match List I with List II :

List IList II
A. Fibrous jointsI. Adjacent vertebrae, limited movement
B. Cartilaginous jointsII. Humerus and Pectoral girdle, rotational
C. Hinge jointsIII. Skull, don’t allow any movement
D. Ball and socket jointsIV. Knee, help in locomotion

Choose the correct answer from the options given below:

(1) A-IV, B-II, C-III, D-I

(2) A-I, B-III, C-II, D-IV

(3) A-II, B-III, C-I, D-IV

(4) A-III, B-I, C-IV, D-II

Answer: Option (4)


Question: 143. Which of the following are Autoimmune disorders?

A. Myasthenia gravis

B. Rheumatoid arthritis

C. Gout

D. Muscular dystrophy

E. Systemic Lupus Erythematosus (SLE)

Choose the most appropriate answer from the options given below:

(1) A, B & D only

(2) A, B & E only

(3) B, C & E only

(4) C, D & E only

Answer: Option (2)


Question: 144. Which of the following is not a component of Fallopian tube?

(1) Uterine fundus

(2) Isthmus

(3) Infundibulum

(4) Ampulla

Answer: Option (1)


Question: 145. The flippers of the Penguins and Dolphins are the example of the

(1) Adaptive radiation

(2) Natural selection

(3) Convergent evolution

(4) Divergent evolution

Answer: Option (3)


Question: 146. The following diagram showing restriction sites in E.coli cloning vector pBR 322 . Find the role of ‘ X ‘ and ‘ Y ‘ genes.

(1) The gene ‘ X ‘ is responsible for resistance to antibiotics and ‘ Y ‘ for protein involved in the replication of Plasmid.

(2) The gene ‘ X ‘ is responsible for controlling the copy number of the linked DNA and ‘ Y ‘ for protein involved in the replication of Plasmid.

(3) The gene ‘ X ‘ is for protein involved in replication of Plasmid and ‘ Y ‘ for resistance to antibiotics.

(4) Gene ‘ X ‘ is responsible for recognition sites and ‘ Y ‘ is responsible for antibiotic resistance.

Answer: Option (2)


Question: 147. Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R:

Assertion A : Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.

Reason R : Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby.

In the light of the above statements, choose the most appropriate answer from the options given below:

(1) Both A and R are correct and R is the correct explanation of A .

(2) Both A and R are correct but R is NOT the correct explanation of A .

(3) A is correct but R is not correct.

(4) A is not correct but R is correct.

Answer: Option (1)


Question: 148. The “Ti plasmid” of Agrobacterium tumefaciens stands for

(1) Tumour inhibiting plasmid

(2) Tumor independent plasmid

(3) Tumor inducing plasmid

(4) Temperature independent plasmid

Answer: Option (3)


Question: 149. Match List I with List II :

List IList II
A. PleurobrachiaI. Mollusca
B. RadulaII. Ctenophora
C. StomochordIII. Osteichthyes
D. Air bladderIV. Hemichordata

Choose the correct answer from the options given below :

(1) A-IV, B-II, C-III, D-I

(2) A-II, B-I, C-IV, D-III

(3) A-II, B-IV, C-I, D-III

(4) A-IV, B-III, C-II, D-I

Answer: Option (2)


Question: 150. Given below are some stages of human evolution. Arrange them in correct sequence (Past to Recent)

A. Homo habilis

B. Homo sapiens

C. Homo neanderthalensis

D. Homo erectus

Choose the correct sequence of human evolution from the options given below :

(1) D-A-C-B

(2) B-A-D-C

(3) C-B-D-A

(4) A-D-C-B

Answer: Option (4)


Question: 151. Which of the following is not a steroid hormone?

(1) Cortisol

(2) Testosterone

(3) Progesterone

(4) Glucagon

Answer: Option (4)


Question: 152. In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on :

(1) 5^{\text {th }} segment

(2) 10^{\text {th }} segment

(3) 8^{\text {th }} and 9^{\text {th }} segment

(4) 11^{\text {th }} segment

Answer: Option (2)


Question: 153. Which one of the following factors will not affect the Hardy-Weinberg equilibrium ?

(1) Genetic recombination

(2) Genetic drift

(3) Gene migration

(4) Constant gene pool

Answer: Option (4)


Question: 154. Match List I with List II :

List IList II
A. PonsI. Provides additional space for Neurons, regulates posture and balance.
B. HypothalamusII. Controls respiration and gastric secretions
C. MedullaIII. Connects different regions of the brain
D. CerebellumIV. Neuro secretory cells

Choose the correct answer from the options given below :

(1) A-II, B-III, C-I, D-IV

(2) A-III, B-IV, C-II, D-I

(3) A-I, B-III, C-II, D-IV

(4) A-II, B-I, C-III, D-IV

Answer: Option (2)


Question: 155. Match List I with List II :

List IList II
A. Down’s syndromeI. 11^{\text {th }} chromosome
B. \alpha-ThalassemiaII. ‘X’ chromosome
C. \beta-ThalassemiaIII. 21^{\text {st }} chromosome
D. Klinefelter’s syndromeIV. 16^{\text {th }} chromosome

Choose the correct answer from the options given below :

(1) A-I, B-II, C-III, D-IV

(2) A-II, B-III, C-IV, D-I

(3) A-III, B-IV, C-I, D-II

(4) A-IV, B-I, C-II, D-III

Answer: Option (3)


Question: 156. Which one is the correct product of DNA dependent RNA polymerase to the given template? 3’TACATGGCAAATATCCATTCA5′

(1) 5’AUGUACCGUUUAUAGGUAAGU3′

(2) 5’AUGUAAAGUUUAUAGGUAAGU3′

(3) 5’AUGUACCGUUUAUAGGGAAGU3′

(4) 5’ATGTACCGTTTATAGGTAAGT3′

Answer: Option (1)


Question: 157. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.

Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male.

Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.

In the light of the above statements, choose the correct answer from the options given below :

(1) Both A and R are true and R is the correct explanation of A .

(2) Both A and R are true but R is NOT the correct explanation of A .

(3) A is true but R is false.

(4) A is false but R is true.

Answer: Option (4)


Question: 158. Which of the following is not a natural/traditional contraceptive method?

(1) Coitus interruptus

(2) Periodic abstinence

(3) Lactational amenorrhea

(4) Vaults

Answer: Option (4)


Question: 159. Match List-I with List-II

List-IList-II
A. Non-medicated IUDI. Multiload 375
B. Copper releasing IUDII. Progestogens
C. Hormone releasing IUDIII. Lippes loop
D. ImplantsIV. LNG-20

Choose the correct answer from the options given below :

(1) A-III, B-I, C-II, D-IV

(2) A-I, B-III, C-IV, D-II

(3) A-IV, B-I, C-II, D-III

(4) A-III, B-I, C-IV, D-II

Answer: Option (4)


Question: 160. Consider the following statements:

A. Annelids are true coelomates

B. Poriferans are pseudocoelomates

C. Aschelminthes are acoelomates

D. Platyhelminthes are pseudocoelomates

Choose the correct answer from the options given below :

(1) B only

(2) A only

(3) C only

(4) D only

Answer: Option (2)


Question: 161. Three types of muscles are given as \mathrm{a}, \mathrm{b} and c . Identify the correct matching pair along with their location in human body:

Name of muscle/location

(1) (a) Smooth-Toes
(b) Skeletal-Legs
(c) Cardiac – Heart

(2) (a) Skeletal – Triceps
(b) Smooth – Stomach
(c) Cardiac – Heart

(3) (a) Skeletal – Biceps
(b) Involuntary – Intestine
(c) Smooth – Heart

(4) (a) Involuntary – Nose tip
(b) Skeletal – Bone
(c) Cardiac – Heart

Answer: Option (2)


Question: 162. Following are the stages of pathway for conduction of an action potential through the heart:

A. AV bundle

B. Purkinje fibres

C. AV node

D. Bundle branches

E. SA node

Choose the correct sequence of pathway from the options given below :

(1) E-C-A-D-B

(2) A-E-C-B-D

(3) B-D-E-C-A

(4) E-A-D-B-C

Answer: Option (1)


Question: 163. Match List I with List-II :

List-IList-II
A. LipaseI. Peptide bond
B. NucleaseII. Ester bond
C. ProteaseIII. Glycosidic bond
D. AmylaseIV. Phosphodiester bond

Choose the correct answer from the options given below:

(1) A-IV, B-II, C-III, D-I

(2) A-III, B-II, C-I, D-IV

(3) A-II, B-IV, C-I, D-III

(4) A-IV, B-I, C-III, D-II

Answer: Option (3)


Question: 164. Match List I with List-II :

List-IList-II
A. AxonemeI. Centriole
B. Cartwheel patternII. Cilia and flagella
C. CristaIII. Chromosome
D. StatelliteIV. Mitochondria

Choose the correct answer from the options given below:

(1) A-IV, B-III, C-II, D-I

(2) A-IV, B-II, C-III, D-I

(3) A-II, B-IV, C-I, D-III

(4) A-II, B-I, C-IV, D-III

Answer: Option (4)


Question: 165. Match List I with List-II :

List-I (Sub Phases of Prophase I)List-II (Specific characters)
A. DiakinesisI. Synaptonemal complex formation
B. PachyteneII. Completion of terminalisation of chiasmata
C. ZygoteneIII. Chromosomes look like thin threads
D. LeptoteneIV. Appearance of recombination nodules

Choose the correct answer from the options given below:

(1) A-IV, B-II, C-III, D-I

(2) A-I, B-II, C-IV, D-III

(3) A-II, B-IV, C-I, D-III

(4) A-IV, B-III, C-II, D-I

Answer: Option (3)


Question: 166. Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

(1) High \mathrm{pO}_{2} and High \mathrm{pCO}_{2}

(2) High \mathrm{pO}_{2} and Lesser \mathrm{H}^{+} concentration

(3) Low \mathrm{pCO}_{2} and High \mathrm{H}^{+} concentration

(4) Low \mathrm{pCO}_{2} and High temperature

Answer: Option (2)


Question: 167. Match List I with List-II :

List-IList-II
A. PterophyllumI. Hag fish
B. MyxineII. Saw fish
C. PristisIII. Angel fish
D. ExocoetusIV. Flying fish

Choose the correct answer from the options given below:

(1) A-II, B-I, C-III, D-IV

(2) A-III, B-I, C-II, D-IV

(3) A-IV, B-I, C-II, D-III

(4) A-III, B-II, C-I, D-IV

Answer: Option (2)


Question: 168. Match List I with List II :

List-IList-II
A. TyphoidI. Fungus
B. LeishmaniasisII. Nematode
C. RingwormIII. Protozoa
D. FilariasisIV. Bacteria

Choose the correct answer from the options given below:

(1) A-I, B-III, C-II, D-IV

(2) A-IV, B-III, C-I, D-II

(3) A-III, B-I, C-IV, D-II

(4) A-II, B-IV, C-III, D-I

Answer: Option (2)


Question: 169. Which of the following statements is incorrect?

(1) A bio-reactor provides optimal growth conditions for achieving the desired product.

(2) Most commonly used bio-reactors are of stirring type.

(3) Bio-reactors are used to produce small scale bacterial cultures.

(4) Bio- reactors have an agitator system, an oxygen delivery system and foam control system.

Answer: Option (3)


Question: 170. Given below are two statements:

Statement I : In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes.

Statement II : The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.

In the light of the above statements, choose the correct answer from the options given below :

(1) Both Statement I and Statement II are true.

(2) Both Statement I and Statement II are false.

(3) Statement I is true but Statement II is false.

(4) Statement I is false but Statement II is true.

Answer: Option (2)


Question: 171. Given below are two statement:

Statement I: The presence or absence of hymen is not a reliable indicator of virginity.

Statement II : The hymen is torn during the first coitus only.

In the light of the above statements, choose the correct answer from the options given below :

(1) Both Statement I and Statement II are true

(2) Both Statement I and Statement II are false.

(3) Statement I is true but Statement II is false.

(4) Statement I is false but Statement II is true.

Answer: Option (3)


Question: 172. Match List I with List II :

List IList II
A. Expiratory capacityI. Expiratory reserve volume + Tidal Volume + Inspiratory reserve volume
B. Functional residual capacityII. Tidal volume + Expiratory reserve volume
C. Vital capacityIII. Tidal volume + Inspiratory reserve volume
D. Inspiratory capacityIV Expiratory reserve volume + Residual volume

Choose the correct answer from the options given below

(1) A-II, B-IV,C-I,D-III

(2) A-III, B-II,C-IV,D-I

(3) A-II, B-I,C-IV,D-III

(4) A-I, B-III,C-II,D-IV

Answer: Option (1)


Question: 173. Following are the stages of cell division :

A. Gap 2 phase

B. Cytokinesis

C. Synthesis phase

D. Karyokinesis

E. Gap 1 phase

Choose the correct sequence of stages from the options given below :

(1) C-E-D-A-B

(2) E-B-D-A-C

(3) B-D-E-A-C

(4) E-C-A-D-B

Answer: Option (4)


Question: 174. Given below are two statements:

Statement I: Mitochondria and chloroplasts are both double membrane bound organelles.

Statement II : Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast.

In the light of the above statement, choose the most appropriate answer from the options given below :

(1) Both Statement I and Statement II are correct

(2) Both Statement I and Statement II are incorrect.

(3) Statement I is correct but Statement II is incorrect.

(4) Statement I is incorrect but Statement II is correct

Answer: Option (3)


Question: 175. Match List I with List II

List IList II
A. Mesozoic EraI. Lower invertebrates
B. Proterozoic EraII. Fish & Amphibia
C. Cenozoic EraIII. Birds & Reptiles
D. Paleozoic EraIV Mammals

Choose the correct answer from the options given below:

(1) A-II, B-I,C-III,D-IV

(2) A-III, B-I,C-II,D-IV

(3) A-I, B-II,C-IV,D-III

(4) A-III, B-I,C-IV,D-II

Answer: Option (4)


Question: 176. Given below are two statements:

Statement I : Gause’s competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

Statement II : According to Gause’s principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.

In the light of the above statements, choose the correct answer from the options given below.

(1) Both Statement I and Statement II are true

(2) Both Statement I and Statement II are false.

(3) Statement I is true but Statement II is false.

(4) Statement I is false but Statement II is true.

Answer: Option (4)


Question: 177. Match List I with List II

List IList II
A. Unicellular glandular epitheliumI. Salivary glands
B. Compound epitheliumII. Pancreas
C. Multicellular glandular epitheliumIII. Goblet cells of epithelium
D. Endocrine epitheliumIV. Moist surface of buccal cavity

Choose the correct answer from the options given below:

(1) A-II, B-I,C-III,D-IV

(2) A-IV, B-III,C-I,D-II

(3) A-III, B-IV,C-I,D-II

(4) A-II, B-I,C-IV,D-III

Answer: Option (3)


Question: 178. Match List I with List II related to digestive system of cockroach.

List IList II
A. The structures used for storing of food.I. Gizzard
B. Ring of 6-8 blind tubules at junction of foregut and midgut.II. Gastric Caeca
C. Ring of 100-150 yellow coloured thin filaments at junction of midgut and hindgut.III. Malpighian tubules
D. The structures used for grinding the food.IV. Crop

Choose the correct answer from the options given below:

(1) A-IV, B-II,C-III,D-I

(2) A-I, B-II,C-III,D-IV

(3) A-IV, B-III,C-II,D-I

(4) A-III, B-II,C-IV,D-I

Answer: Option (1)


Question: 179. Choose the correct statement given below regarding juxta medullary nephron.

(1) Juxta medullary nephrons are located in the coloumns of Bertini.

(2) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.

(3) Loop of Henle of juxta medullary nephron runs deep into medulla.

(4) Juxta medullary nephrons outnumber the cortical nephrons.

Answer: Option (3)


Question: 180. Given below are two statements:

Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.

Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.

In the light of the above statements, choose the most appropriate answer from the options given below:

(1) Both Statement I and Statement II are correct.

(2) Both Statement I and Statement II are incorrect.

(3) Statement I is correct but Statement II is incorrect.

(4) Statement I is incorrect but Statement II is correct.

Answer: Option (3)

Scroll to Top