Please Note:
(1) This answer page is long and contains multiple equations and images. (2) It may take a few seconds to load completely, especially on mobile devices. (3) Please scroll slowly and smoothly to allow equations and images to render properly.
Question: 1 The magnetic energy stored in an inductor of inductance 4 \mu \mathrm{H} carrying a current of 2 A is :
(1) 8 mJ
(2) 8 \mu \mathrm{~J}
(3) 4 \mu \mathrm{~J}
(4) 4 mJ
Answer: Option (2)
Question: 2 A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?
(1) Capacitor
(2) Load resistance
(3) A centre-tapped transformer
(4) p-n junction diodes
Answer: Option (1)
Question: 3 An electric dipole is placed at an angle of 30^{\circ} with an electric field of intensity 2 \times 10^{5} \mathrm{NC}^{-1}. It experiences a torque equal to 4 N m . Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm .
(1) 4 mC
(2) 2 mC
(3) 8 mC
(4) 6 mC
Answer: Option (2)
Question: 4 The equivalent capacitance of the system shown in the following circuit is :
(1) 6 \mu \mathrm{~F}
(2) 9 \mu \mathrm{~F}
(3) 2 \mu \mathrm{~F}
(4) 3 \mu \mathrm{~F}
Answer: Option (3)
Question: 5 In hydrogen spectrum, the shortest wavelength in the Balmer series is \lambda. The shortest wavelength in the Bracket series is :
(1) 9 \lambda
(2) 16 \lambda
(3) 2 \lambda
(4) 4 \lambda
Answer: Option (4)
Question: 6 Resistance of a carbon resistor determined from colour codes is (22000 \pm 5 \%) \Omega. The colour of third band must be :
(1) Orange
(2) Yellow
(3) Red
(4) Green
Answer: Option (1)
Question: 7 Two bodies of mass m and 9 m are placed at a distance R. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be ( G= gravitational constant) :
(1) -\frac{16 G m}{R}
(2) -\frac{20 G m}{R}
(3) -\frac{8 G m}{R}
(4) -\frac{12 G m}{R}
Answer: Option (1)
Question: 8 If the galvanometer G does not show any deflection in the circuit shown, the value of R is given by :
(1) 100 \Omega
(2) 400 \Omega
(3) 200 \Omega
(4) 50 \Omega
Answer: Option (1)
Question: 9 For Young’s double slit experiment, two statements are given below:
Statement I: If screen is moved away from the plane of slits, angular separation of the fringes remains constant.
Statement II : If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is true but Statement II is false.
(2) Statement I is false but Statement II is true.
(3) Both Statement I and Statement II are true.
(4) Both Statement I and Statement II are false.
Answer: Option (1)
Question: 10 The venturi-meter works on :
(1) The principle of parallel axes
(2) The principle of perpendicular axes
(3) Huygen’s principle
(4) Bernoulli’s principle
Answer: Option (4)
Question 11: Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end. The longitudinal stress at any point of cross-sectional area A of the wire is :
(1) \frac{W}{2A}
(2) Zero
(3) \frac{2W}{A}
(4) \frac{W}{A}
Answer: Option (4)
Question 12: The angular acceleration of a body, moving along the circumference of a circle, is :
(1) along the tangent to its position
(2) along the axis of rotation
(3) along the radius, away from centre
(4) along the radius towards the centre
Answer: Option (2)
Question 13: The temperature of a gas is -50^{\circ}\mathrm{C}. To what temperature the gas should be heated so that the rms speed is increased by 3 times?
(1) 3097 K
(2) 223 K
(3) 669^{\circ}\mathrm{C}
(4) 3295^{\circ}\mathrm{C}
Answer: Option (4)
Question 14: The work functions of Caesium (Cs), Potassium (K) and Sodium (Na) are 2.14 eV , 2.30 eV and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV , which of these photosensitive surfaces may emit photoelectrons?
(1) K only
(2) Na only
(3) Cs only
(4) Both Na and K
Answer: Option (3)
Question 15: An ac source is connected to a capacitor C. Due to decrease in its operating frequency :
(1) displacement current decreases.
(2) capacitive reactance remains constant
(3) capacitive reactance decreases.
(4) displacement current increases.
Answer: Option (1)
Question 16: Light travels a distance x in time t_{1} in air and 10x in time t_{2} in another denser medium. What is the critical angle for this medium?
(1) \sin^{-1}\left(\frac{t_{1}}{10t_{2}}\right)
(2) \sin^{-1}\left(\frac{10t_{1}}{t_{2}}\right)
(3) \sin^{-1}\left(\frac{t_{2}}{t_{1}}\right)
(4) \sin^{-1}\left(\frac{10t_{2}}{t_{1}}\right)
Answer: Option (2)
Question 17: The net magnetic flux through any closed surface is :
(1) Infinity
(2) Negative
(3) Zero
(4) Positive
Answer: Option (3)
Question: 18 A 12 \mathrm{~V}, 60 \mathrm{~W} lamp is connected to the secondary of a step down transformer, whose primary is connected to ac mains of 220 V . Assuming the transformer to be ideal, what is the current in the primary winding?
(1) 3.7 A
(2) 0.37 A
(3) 0.27 A
(4) 2.7 A
Answer: Option (3)
Question 19: A metal wire has mass (0.4 \pm 0.002)\,\mathrm{g}, radius (0.3 \pm 0.001)\,\mathrm{mm} and length (5 \pm 0.02)\,\mathrm{cm}. The maximum possible percentage error in the measurement of density will nearly be:
(1) 1.6\%
(2) 1.4\%
(3) 1.2\%
(4) 1.3\%
Answer: Option (1)
Question 20: Given below are two statements:
Statement I: Photovoltaic devices can convert optical radiation into electricity.
Statement II : Zener diode is designed to operate under reverse bias in breakdown region.
In the light of the above statements, choose the most appropriate answer from the options given below :
(1) Statement I is correct but Statement II is incorrect.
(2) Statement I is incorrect but Statement II is correct.
(3) Both Statement I and Statement II are correct.
(4) Both Statement I and Statement II are incorrect.
Answer: Option (3)
Question 21: A bullet is fired from a gun at the speed of 280 \mathrm{~m} \mathrm{~s}^{-1} in the direction 30^{\circ} above the horizontal. The maximum height attained by the bullet is \left(\mathrm{g}=9.8 \mathrm{~m} \mathrm{~s}^{-2}, \sin 30^{\circ}=0.5\right) :
(1) 1000 m
(2) 3000 m
(3) 2800 m
(4) 2000 m
Answer: Option (1)
Question 22: A Carnot engine has an efficiency of 50% when its source is at a temperature 327^{\circ}\mathrm{C}. The temperature of the sink is :
(1) 100^{\circ}\mathrm{C}
(2) 200^{\circ}\mathrm{C}
(3) 27^{\circ}\mathrm{C}
(4) 15^{\circ}\mathrm{C}
Answer: Option (3)
Question 23: The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly : (surface tension of soap solution =0.03 \mathrm{~N} \mathrm{~m}^{-1} )
(1) 3.01 \times 10^{-4} \mathrm{~J}
(2) 50.1 \times 10^{-4} \mathrm{~J}
(3) 30.16 \times 10^{-4} \mathrm{~J}
(4) 5.06 \times 10^{-4} \mathrm{~J}
Answer: Option (1)
Question 24: The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of V volts is proportional to:
(1) \frac{1}{\sqrt{V}}
(2) V^{2}
(3) \sqrt{V}
(4) \frac{1}{V}
Answer: Option (4)
Question 25: In a series L C R circuit, the inductance L is 10 mH , capacitance C is 1 \mu \mathrm{~F} and resistance R is 100 \Omega. The frequency at which resonance occurs is :
(1) 1.59 \mathrm{rad} / \mathrm{s}
(2) 1.59 kHz
(3) 15.9 \mathrm{rad} / \mathrm{s}
(4) 15.9 kHz
Answer: Option (2)
Question 26: The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8 cm , potential energy stored in it will be :
(1) 8 U
(2) 16 U
(3) 2 U
(4) 4 U
Answer: Option (2)
Question 27: The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to \left(\frac{1}{16}\right)^{\text{th}} of its initial value?
(1) 60 minutes
(2) 80 minutes
(3) 20 minutes
(4) 40 minutes
Answer: Option (2)
Question 28: If \oint_{S} \vec{E} \cdot \overrightarrow{d S}=0 over a surface, then :
(1) all the charges must necessarily be inside the surface.
(2) the electric field inside the surface is necessarily uniform.
(3) the number of flux lines entering the surface must be equal to the number of flux lines leaving it.
(4) the magnitude of electric field on the surface is constant.
Answer: Option (3)
Question 29: The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is :
(1) 1:3
(2) 3:1
(3) 1:2
(4) 2:1
Answer: Option (4)
Question 30: The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :
(1) Least count errors
(2) Random errors
(3) Instrumental errors
(4) Personal errors
Answer: Option (2)
Question 31: In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of 2.0 \times 10^{10} \mathrm{~Hz} and amplitude 48 \mathrm{Vm}^{-1}. Then the amplitude of oscillating magnetic field is : (Speed of light in free space =3 \times 10^{8} \mathrm{~m} \mathrm{~s}^{-1} )
(1) 1.6 \times 10^{-7} \mathrm{~T}
(2) 1.6 \times 10^{-6} \mathrm{~T}
(3) 1.6 \times 10^{-9} \mathrm{~T}
(4) 1.6 \times 10^{-8} \mathrm{~T}
Answer: Option (4)
Question 32: A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is :
(1) along north-east
(2) along south-west
(3) along eastward
(4) along northward
Answer: Option (1)
Question 33: The magnitude and direction of the current in the following circuit is
(1) \frac{5}{9} A from A to B through E
(2) 1.5 A from B to A through E
(3) 0.2 A from B to A through E
(4) 0.5 A from A to B through E
Answer: Option (4)
Question 34: A vehicle travels half the distance with speed \vartheta and the remaining distance with speed 2 \vartheta. Its average speed is:
(1) \frac{4 \vartheta}{3}
(2) \frac{3 \vartheta}{4}
(3) \frac{\vartheta}{3}
(4) \frac{2 \vartheta}{3}
Answer: Option (1)
Question 35: The radius of inner most orbit of hydrogen atom is 5.3 \times 10^{-11} \mathrm{~m}. What is the radius of third allowed orbit of hydrogen atom?
(1) 1.59 \AA
(2) 4.77 \AA
(3) 0.53 \AA
(4) 1.06 \AA
Answer: Option (2)
Question 36: 10 resistors, each of resistance R are connected in series to a battery of emf E and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased n times. The value of n is :
(1) 1
(2) 1000
(3) 10
(4) 100
Answer: Option (4)
Question 37: The x – t graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at t=2 \mathrm{~s} is :
(1) \frac{\pi^{2}}{16} \mathrm{~m} \mathrm{~s}^{-2}
(2) -\frac{\pi^{2}}{16} \mathrm{~m} \mathrm{~s}^{-2}
(3) \frac{\pi^{2}}{8} \mathrm{~m} \mathrm{~s}^{-2}
(4) -\frac{\pi^{2}}{8} \mathrm{~m} \mathrm{~s}^{-2}
Answer: Option (2)
Question 38: Two thin lenses are of same focal lengths (f), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be :
(1) f / 2
(2) Infinite
(3) Zero
(4) f / 4
Answer: Option (2)
Question 39: A satellite is orbiting just above the surface of the earth with period T. If d is the density of the earth and G is the universal constant of gravitation, the quantity \frac{3 \pi}{G d} represents :
(1) T^{3}
(2) \sqrt{T}
(3) T
(4) T^{2}
Answer: Option (4)
Question 40: Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15\left(\mathrm{~g}=10 \mathrm{~m} \mathrm{~s}^{-2}\right).
(1) 1.5 \mathrm{~m} \mathrm{~s}^{-2}
(2) 50 \mathrm{~m} \mathrm{~s}^{-2}
(3) 1.2 \mathrm{~m} \mathrm{~s}^{-2}
(4) 150 \mathrm{~m} \mathrm{~s}^{-2}
Answer: Option (1)
Question 41: An electric dipole is placed as shown in the figure. The electric potential (in 10^{2} \mathrm{~V} ) at point P due to the dipole is ( \epsilon_{0}= permittivity of free space and \frac{1}{4 \pi \epsilon_{0}}=\mathrm{K} ):
(1) \left(\frac{8}{5}\right) \mathrm{qK}
(2) \left(\frac{8}{3}\right) \mathrm{qK}
(3) \left(\frac{3}{8}\right) \mathrm{qK}
(4) \left(\frac{5}{8}\right) \mathrm{qK}
Answer: Option (3)
Question 42: The net impedance of circuit (as shown in figure) will be :
(1) 5 \sqrt{5} \Omega
(2) 25 \Omega
(3) 10 \sqrt{2} \Omega
(4) 15 \Omega
Answer: Option (1)
Question 43: For the following logic circuit, the truth table is:
Answer: Option (4)
Question 44: A bullet from a gun is fired on a rectangular wooden block with velocity u. When bullet travels 24 cm through the block along its length horizontally, velocity of bullet becomes \frac{u}{3}. Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is :
(1) 28 cm
(2) 30 cm
(3) 27 cm
(4) 24 cm
Answer: Option (3)
Question 45: The resistance of platinum wire at 0^{\circ} \mathrm{C} is 2 \Omega and 6.8 \Omega at 80^{\circ} \mathrm{C}. The temperature coefficient of resistance of the wire is :
(1) 3 \times 10^{-2}{ }^{\circ} \mathrm{C}^{-1}
(2) 3 \times 10^{-1}{ }^{\circ} \mathrm{C}^{-1}
(3) 3 \times 10^{-4}{ }^{\circ} \mathrm{C}^{-1}
(4) 3 \times 10^{-3}{ }^{\circ} \mathrm{C}^{-1}
Answer: Option (1)
Question 46: Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : A reaction can have zero activation energy.
Reasons R : The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy.
In the light of the above statements, choose the correct answer from the options given below :
(1) \mathbf{A} is true but \mathbf{R} is false.
(2) \mathbf{A} is false but \mathbf{R} is true.
(3) Both \mathbf{A} and \mathbf{R} are true and \mathbf{R} is the correct explanation of \mathbf{A}.
(4) Both \mathbf{A} and \mathbf{R} are true and \mathbf{R} is NOT the correct explanation of \mathbf{A}.
Answer: Option (2)
Question 47: The correct order of energies of molecular orbitals of \mathrm{N}_{2} molecule, is :
1) \sigma{1s} < \sigma^{*}{1s} < \sigma{2s} < \sigma^{*}{2s} < \sigma{2p_z}< \sigma^{*}{2p_z}< \left( \pi_{2p_x} = \pi_{2p_y} \right) < \left( \pi^{*}{2p_x} = \pi^{*}{2p_y} \right)
2) \sigma{1s} < \sigma^{*}{1s} < \sigma{2s} < \sigma^{*}{2s} < \left( \pi_{2p_x} = \pi_{2p_y} \right) < \left( \pi^{*}{2p_x} = \pi^{*}{2p_y} \right)< \sigma{2p_z}< \sigma^{*}{2p_z}
3) \sigma{1s} < \sigma^{*}{1s} < \sigma{2s} < \sigma^{*}{2s} < \left( \pi_{2p_x} = \pi_{2p_y} \right)< \sigma{2p_z}< \left( \pi^{*}{2p_x} = \pi^{*}{2p_y} \right)< \sigma^{*}{2p_z}
4) \sigma{1s} < \sigma^{*}{1s} < \sigma{2s} < \sigma^{*}{2s} < \sigma{2p_z}< \sigma{2p_z}<\left( \pi_{2p_x} = \pi_{2p_y} \right) < \left( \pi^{*}{2p_x} = \pi^{*}{2p_y} \right)< \sigma^{*}{2p_z}
Answer: Option (3)
Question 48: The given compound is an example of \_\_\_\_ .
(1) allylic halide
(2) vinylic halide
(3) benzylic halide
(4) aryl halide
Answer: Option (1)
Question 49: Homoleptic complex from the following complexes is :
(1) Pentaamminecarbonatocobalt (III) chloride
(2) Triamminetriaquachromium (III) chloride
(3) Potassium trioxalatoaluminate (III)
(4) Diamminechloridonitrito – N platinum (II)
Answer: Option (3)
Question 50: The right option for the mass of \mathrm{CO}_{2} produced by heating 20 g of 20 \% pure limestone is (Atomic mass of \mathrm{Ca}=40 )
\mathrm{CaCO}_{3} \xrightarrow{1200 \mathrm{~K}} \mathrm{CaO}+\mathrm{CO}_{2}(1) 2.64 g
(2) 1.32 g
(3) 1.12 g
(4) 1.76 g
Answer: Option (4)
Question 51: The relation between \mathrm{n}_{\mathrm{m}},\left(\mathrm{n}_{\mathrm{m}}=\right. the number of permissible values of magnetic quantum number (m)) for a given value of azimuthal quantum number ( l ), is
(1) \mathrm{n}_{\mathrm{m}}=2 l^{2}+1
(2) \mathrm{n}_{\mathrm{m}}=l+2
(3) l=\frac{n_{m}-1}{2}
(4) l=2 n_{m}+1
Answer: Option (3)
Question 52: Select the correct statements from the following :
A. Atoms of all elements are composed of two fundamental particles.
B. The mass of the electron is 9.10939 \times 10^{-31} \mathrm{~kg}.
C. All the isotopes of a given element show same chemical properties.
D. Protons and electrons are collectively known as nucleons.
E. Dalton’s atomic theory, regarded the atom as an ultimate particle of matter.
Choose the correct answer from the options given below :
(1) A and E only
(2) B, C and E only
(3) A, B and C only
(4) C, D and E only
Answer: Option (2)
Question 53: Which one is an example of heterogenous catalysis?
(1) Decomposition of ozone in presence of nitrogen monoxide.
(2) Combination between dinitrogen and dihydrogen to form ammonia in the presence of finely divided iron.
(3) Oxidation of sulphur dioxide into sulphur trioxide in the presence of oxides of nitrogen.
(4) Hydrolysis of sugar catalysed by \mathrm{H}^{+} ions.
Answer: Option (2)
Question 54: Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in presence of calcium oxide is :
(1) 30
(2) 18
(3) 16
(4) 32
Answer: Option (4)
Question 55: The number of \sigma bonds, \pi bonds and lone pair of electrons in pyridine, respectively are:
(1) 11,3,1
(2) 12,2,1
(3) 11,2,0
(4) 12,3,0
Answer: Option (1)
Question 56: Which amongst the following molecules on polymerization produces neoprene?
Answer: Option (4)
Question 57: The stability of \mathrm{Cu}^{2+} is more than \mathrm{Cu}^{+} salts in aqueous solution due to –
(1) hydration energy.
(2) second ionisation enthalpy.
(3) first ionisation enthalpy.
(4) enthalpy of atomization.
Answer: Option (1)
Question 58: Complete the following reaction :
[A] on treatment with \mathrm{HCN} gives [B]. On heating [B]
with concentrated \mathrm{H_2SO_4}, [C] is formed.
Answer: Option (2)
Question 59: Which of the following reactions will NOT give primary amine as the product?
Answer: Option (1)
Question 60: Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : Helium is used to dilute oxygen in diving apparatus.
Reasons R : Helium has high solubility in \mathrm{O}_{2}.
In the light of the above statements, choose the correct answer from the options given below :
(1) \mathbf{A} is true but \mathbf{R} is false.
(2) \mathbf{A} is false but \mathbf{R} is true.
(3) Both \mathbf{A} and \mathbf{R} are true and \mathbf{R} is the correct explanation of \mathbf{A}.
(4) Both \mathbf{A} and \mathbf{R} are true and \mathbf{R} is NOT the correct explantion of \mathbf{A}.
Answer: Option (1)
Question 61: Identify the product in the following reaction:
A benzene diazonium chloride is treated successively with (i) \mathrm{Cu_2Br_2/HBr}, (ii) \mathrm{Mg/dry\ ether} and (iii) \mathrm{H_2O}.
Answer: Option (4)
Question 62: Consider the following reaction and identify the product (P).
\mathrm{CH_3-CH(CH_3)-CH(OH)-CH_3} reacts with \mathrm{HBr}.
Answer: Option (3)
Question 63: Identify product (A) in the following reaction:
An aromatic compound containing two carbonyl groups is treated with \mathrm{Zn\!-\!Hg} and concentrated \mathrm{HCl} to give product (A) along with 2\mathrm{H_2O}.
Answer: Option (3)
Question 64: Taking stability as the factor, which one of the following represents correct relationship?
(1) \mathrm{AlCl}>\mathrm{AlCl}_{3}
(2) \mathrm{TlI}>\mathrm{TlI}_{3}
(3) \mathrm{TlCl}_{3}>\mathrm{TlCl}
(4) \mathrm{InI}_{3}>\mathrm{InI}
Answer: Option (2)
Question 65: The conductivity of centimolar solution of KCl at 25^{\circ} \mathrm{C} is 0.0210 \mathrm{ohm}^{-1} \mathrm{~cm}^{-1} and the resistance of the cell containing the solution at 25^{\circ} \mathrm{C} is 60 ohm. The value of cell constant is –
(1) 1.26 \mathrm{~cm}^{-1}
(2) 3.34 \mathrm{~cm}^{-1}
(3) 1.34 \mathrm{~cm}^{-1}
(4) 3.28 \mathrm{~cm}^{-1}
Answer: Option (1)
Question 66: Which one of the following statements is correct?
(1) The bone in human body is an inert and unchanging substance.
(2) Mg plays roles in neuromuscular function and interneuronal transmission.
(3) The daily requirement of Mg and Ca in the human body is estimated to be 0.2\!-\!0.3 \ \mathrm{g}.
(4) All enzymes that utilise ATP in phosphate transfer require Ca as the cofactor.
Answer: Option (3)
Question 67: Match List – I with List – II :
| List – I | List – II |
|---|---|
| A. Coke | I. Carbon atoms are \mathrm{sp}^{3} hybridised. |
| B. Diamond | II. Used as a dry lubricant |
| C. Fullerene | III. Used as a reducing agent |
| D. Graphite | IV. Cage like molecules |
Choose the correct answer from the options given below :
(1) A-III, B-I, C-IV, D-II
(2) A-III, B-IV, C-I, D-II
(3) A-II, B-IV, C-I, D-III
(4) A-IV, B-I, C-II, D-III
Answer: Option (1)
Question 68: Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic.
Reasons R : The deep blue solution is due to the formation of amide.
In the light of the above statements, choose the correct answer from the options given below :
(1) \mathbf{A} is true but \mathbf{R} is false.
(2) \mathbf{A} is false but \mathbf{R} is true.
(3) Both \mathbf{A} and \mathbf{R} are true and \mathbf{R} is the correct explanation of \mathbf{A}.
(4) Both \mathbf{A} and \mathbf{R} are true but \mathbf{R} is NOT the correct explanation of \mathbf{A}.
Answer: Option (1)
Question 69: Which of the following statements are NOT correct?
A. Hydrogen is used to reduce heavy metal oxides to metals.
B. Heavy water is used to study reaction mechanism.
C. Hydrogen is used to make saturated fats from oils.
D. The \mathrm{H}-\mathrm{H} bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any element.
E. Hydrogen reduces oxides of metals that are more active than iron.
Choose the most appropriate answer from the options given below :
(1) D, E only
(2) A, B, C only
(3) B, C, D, E only
(4) B, D only
Answer: Option (1)
Question 70: The element expected to form largest ion to achieve the nearest noble gas configuration is :
(1) N
(2) Na
(3) O
(4) F
Answer: Option (1)
Question 71: In Lassaigne’s extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with \mathrm{Fe}^{3+} due to the formation of –
(1) \left[\mathrm{Fe}(\mathrm{CN})_{5} \mathrm{NOS}\right]^{4-}
(2) [\mathrm{Fe}(\mathrm{SCN})]^{2+}
(3) \mathrm{Fe}_{4}\left[\mathrm{Fe}(\mathrm{CN})_{6}\right]_{3} \cdot \mathrm{xH}_{2} \mathrm{O}
(4) NaSCN
Answer: Option (2)
Question 72: Intermolecular forces are forces of attraction and repulsion between interacting particles that will include :
A. dipole-dipole forces.
B. dipole – induced dipole forces.
C. hydrogen bonding.
D. covalent bonding.
E. dispersion forces.
Choose the most appropriate answer from the options given below :
(1) A, B, C, E are correct.
(2) A, C, D, E are correct.
(3) B, C, D, E are correct.
(4) A, B, C, D are correct.
Answer: Option (1)
Question 73: Amongst the following, the total number of species NOT having eight electrons around central atom in its outer most shell, is \mathrm{NH}_{3}, \mathrm{AlCl}_{3}, \mathrm{BeCl}_{2}, \mathrm{CCl}_{4}, \mathrm{PCl}_{5} :
(1) 4
(2) 1
(3) 3
(4) 2
Answer: Option (3)
Question 74: A compound is formed by two elements A and B . The element B forms cubic close packed structure and atoms of A occupy 1 / 3 of tetrahedral voids. If the formula of the compound is \mathrm{A}_{\mathrm{x}} \mathrm{B}_{\mathrm{y}}, then the value of x+y is in option
(1) 3
(2) 2
(3) 5
(4) 4
Answer: Option (3)
Question 75: Some tranquilizers are listed below. Which one from the following belongs to barbiturates?
(1) Valium
(2) Veronal
(3) Chlordiazepoxide
(4) Meprobamate
Answer: Option (2)
Question 76: Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : In equation \Delta_{\mathrm{r}} \mathrm{G}=-\mathrm{nFE}_{\text {cell }}, value of \Delta_{\mathrm{r}} \mathrm{G} depends on n.
Reasons R: \mathrm{E}_{\text {cell }} is an intensive property and \Delta_{\mathrm{r}} \mathrm{G} is an extensive property.
In the light of the above statements, choose the correct answer from the options given below :
(1) \mathbf{A} is true but \mathbf{R} is false.
(2) \mathbf{A} is false but \mathbf{R} is true.
(3) Both \mathbf{A} and \mathbf{R} are true and \mathbf{R} is the correct explanation of \mathbf{A}.
(4) Both \mathbf{A} and \mathbf{R} are true and \mathbf{R} is NOT the correct explanation of \mathbf{A}.
Answer: Option (3)
Question 77: Given below are two statements :
Statement I : A unit formed by the attachment of a base to 1^{\prime} position of sugar is known as nucleoside
Statement II : When nucleoside is linked to phosphorous acid at 5^{\prime}-position of sugar moiety, we get nucleotide.
In the light of the above statements, choose the correct answer from the options given below :
(1) Statement I is true but Statement II is false.
(2) Statement I is false but Statement II is true.
(3) Both Statement I and Statement II are true.
(4) Both Statement I and Statement II are false.
Answer: Option (1)
Question 78: For a certain reaction, the rate =\mathrm{k}[\mathrm{A}]^{2}[\mathrm{~B}], when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would
(1) increase by a factor of nine.
(2) increase by a factor of three.
(3) decrease by a factor of nine.
(4) increase by a factor of six.
Answer: Option (1)
Question 79: Amongst the given options which of the following molecules / ion acts as a Lewis acid?
(1) \mathrm{BF}_{3}
(2) \mathrm{OH}^{-}
(3) \mathrm{NH}_{3}
(4) \mathrm{H}_{2} \mathrm{O}
Answer: Option (1)
Question 80: Which of the following statements are INCORRECT?
A. All the transition metals except scandium form MO oxides which are ionic.
B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in \mathrm{Sc}_{2} \mathrm{O}_{3} to \mathrm{Mn}_{2} \mathrm{O}_{7}.
C. Basic character increases from \mathrm{V}_{2} \mathrm{O}_{3} to \mathrm{V}_{2} \mathrm{O}_{4} to \mathrm{V}_{2} \mathrm{O}_{5}.
D. \mathrm{V}_{2} \mathrm{O}_{4} dissolves in acids to give
\mathrm{VO}_{4}^{3-} salts.
E. CrO is basic but \mathrm{Cr}_{2} \mathrm{O}_{3} is amphoteric.
Choose the correct answer from the options given below :
(1) C and D only
(2) B and C only
(3) A and E only
(4) B and D only
Answer: Option (1)
Question 81: What fraction of one edge centred octahedral void lies in one unit cell of fcc?
(1) \frac{1}{4}
(2) \frac{1}{12}
(3) \frac{1}{2}
(4) \frac{1}{3}
Answer: Option (1)
Question 82: Match List – I with List – II :
| List – I (Oxoacids of Sulphur) | List – II (Bonds) |
|---|---|
| A. Peroxodisulphuric acid | I. Two \mathrm{S}-\mathrm{OH}, Four \mathrm{S}=\mathrm{O}, One S-O-S |
| B. Sulphuric acid | II. Two S-OH, One S=O |
| C. Pyrosulphuric acid | III. Two \mathrm{S}-\mathrm{OH}, Four \mathrm{S}=\mathrm{O}, One S-O-O-S |
| D. Sulphurous acid | IV. Two \mathrm{S}-\mathrm{OH}, Two \mathrm{S}=\mathrm{O} |
Choose the correct answer from the options given below :
(1) A-I, B-III, C-IV, D-II
(2) A-III, B-IV, C-II, D-I
(3) A-I, B-III, C-II, D-IV
(4) A-III, B-IV, C-I, D-II
Answer: Option (4)
Question 83: Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?
(1) \Delta \mathrm{H}-\Delta \mathrm{U}=-\Delta \mathrm{nRT}
(2) \Delta \mathrm{H}+\Delta \mathrm{U}=\Delta \mathrm{nR}
(3) \Delta \mathrm{H}=\Delta \mathrm{U}-\Delta \mathrm{n}_{\mathrm{g}} \mathrm{RT}
(4) \Delta \mathrm{H}=\Delta \mathrm{U}+\Delta \mathrm{n}_{\mathrm{g}} \mathrm{RT}
Answer: Option (1)
Question 84: Given below are two statements :
Statement I : The nutrient deficient water bodies lead to eutrophication.
Statement II : Eutrophication leads to decrease in the level of oxygen in the water bodies.
In the light of the above statements, choose the correct answer from the options given below :
(1) Statement I is correct but Statement II is false.
(2) Statement I is incorrect but Statement II is true.
(3) Both Statement I and Statement II are true.
(4) Both Statement I and Statement II are false.
Answer: Option (2)
Question 85: Pumice stone is an example of –
(1) solid sol
(2) foam
(3) sol
(4) gel
Answer: Option (1)
Que.86 The order of relative stability of the contributing structure is:
Choose the correct answer from the options given below:
(1) I > II > III
(2) II > I > III
(3) I=II= III
(4) III > II > I
Ans. (1)
Question.87 Which among the following halide/s will not show S_{N} 1 reaction:
(A) H_{2} C=CH-CH_{2} Cl
(B) CH_{3}-CH=CH-Cl
(C) ClCc1ccccc1
(D) CC(C)Cl
Choose the most appropriate answer from the options given below:
(1) (A), (B) and (D) only
(2) (A) and (B) only
(3) (B) and (C) only
(4) (B) only
Ans. (4)
Question.88 Which of the following statements is not correct about rusting of iron?
(1) Coating of iron surface by tin prevents rusting, even if the tin coating is peeling off.
(2) When pH lies above 9 or 10, rusting of iron does not take place.
(3) Dissolved acidic oxides SO_{2}, NO_{2} in water act as catalyst in the process of rusting.
(4) Rusting of iron is envisaged as setting up of electrochemical cell on the surface of iron object.
Ans. (1)
Question.89 Given below are two statements:
Statement (I) : In the Lanthanoids, the formation of Ce^{+4} is favoured by its noble gas configuration.
Statement (II) : Ce^{+4} is a strong oxidant reverting to the common +3 state.
In the light of the above statements, choose the most appropriate answer from the options given below:
(1) Statement I is false but Statement II is true
(2) Both Statement I and Statement II are true
(3) Statement I is true but Statement II is false
(4) Both Statement I and Statement II are false
Ans. (2)
Question.90 Choose the correct option having all the elements with d^{10} electronic configuration from the following:
(1) { }^{27} Co,{ }^{28} Ni,{ }^{26} Fe,{ }^{24} Cr
(2) { }^{29} Cu,{ }^{30} Zn,{ }^{48} Cd,{ }^{47} Ag
(3) { }^{46} Pd,{ }^{28} Ni,{ }^{26} Fe,{ }^{24} Cr
(4) { }^{28} Ni,{ }^{24} Cr,{ }^{26} Fe,{ }^{29} Cu
Ans. (2)
Question: 91. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : Late wood has fewer xylary elements with narrow vessels.
Reason R : Cambium is less active in winters.
In the light of the above statements, choose the correct answer from the options given below :
(1) \mathbf{A} is true but \mathbf{R} is false.
(2) \mathbf{A} is false but \mathbf{R} is true.
(3) Both \mathbf{A} and \mathbf{R} are true and R is the correct explanation of \mathbf{A}.
(4) Both \mathbf{A} and \mathbf{R} are true but \mathbf{R} is NOT the correct explanation of \mathbf{A}.
Answer: Option (3)
Question: 92. The historic Convention on Biological Diversity, ‘The Earth Summit’ was held in Rio de Janeiro in the year :
(1) 1986
(2) 2002
(3) 1985
(4) 1992
Answer: Option (4)
Question: 93. In the equation
\mathrm{GPP}-\mathrm{R}=\mathrm{NPP}GPP is Gross Primary Productivity NPP is Net Primary Productivity R here is \_\_\_\_ .
(1) Respiratory loss
(2) Reproductive allocation
(3) Photosynthetically active radiation
(4) Respiratory quotient
Answer: Option (1)
Question: 94. What is the function of tassels in the corn cob?
(1) To disperse pollen grains
(2) To protect seeds
(3) To attract insects
(4) To trap pollen grains
Answer: Option (4)
Question: 95. What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
(1) Transcription of precursor of mRNA
(2) Transcription of only snRNAs
(3) Transcription of rRNAs (28S, 18S and 5.8S)
(4) Transcription of tRNA, 5 srRNA and snRNA
Answer: Option (4)
Question: 96. Upon exposure to UV radiation, DNA stained with ethidium bromide will show
(1) Bright yellow colour
(2) Bright orange colour
(3) Bright red colour
(4) Bright blue colour
Answer: Option (2)
Question: 97 The thickness of ozone in a column of air in the atmosphere is measured in terms of :
(1) Decameter
(2) Kilobase
(3) Dobson units
(4) Decibels
Answer: Option (3)
Question: 98 The phenomenon of pleiotropism refers to
(1) a single gene affecting multiple phenotypic expression.
(2) more than two genes affecting a single character.
(3) presence of several alleles of a single gene controlling a single crossover.
(4) presence of two alleles, each of the two genes controlling a single trait.
Answer: Option (1)
Question: 99 Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?
(1) Zeatin
(2) Abscisic Acid
(3) Indole-3-butyric Acid
(4) Gibberellic Acid
Answer: Option (4)
Question: 100 Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R : Protonema develops directly from spores produced in capsule.
In the light of the above statements, choose the most appropriate answer from the options given below :
(1) \mathbf{A} is correct but \mathbf{R} is not correct.
(2) \mathbf{A} is not correct but \mathbf{R} is correct.
(3) Both \mathbf{A} and \mathbf{R} are correct and \mathbf{R} is the correct explanation of \mathbf{A}.
(4) Both \mathbf{A} and \mathbf{R} are correct but \mathbf{R} is NOT the correct explanation of \mathbf{A}.
Answer: Option (3)
Question: 101 During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
(1) Histones
(2) Polysaccharides
(3) RNA
(4) DNA
Answer: Option (4)
Question: 102 The reaction centre in PS II has an absorption maxima at
(1) 660 nm
(2) 780 nm
(3) 680 nm
(4) 700 nm
Answer: Option (3)
Question: 103 Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
(1) Monoadelphous and Monothecous anthers
(2) Epiphyllous and Dithecous anthers
(3) Diadelphous and Dithecous anthers
(4) Polyadelphous and epipetalous stamens
Answer: Option (3)
Question: 104 Which micronutrient is required for splitting of water molecule during photosynthesis?
(1) magnesium
(2) copper
(3) manganese
(4) molybdenum
Answer: Option (3)
Question: 105 Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species?
(1) Alien species invasions
(2) Co-extinctions
(3) Habitat loss and fragmentation
(4) Over exploitation for economic gain
Answer: Option (3)
Question: 106 Movement and accumulation of ions across a membrane against their concentration gradient can be explained by
(1) Passive Transport
(2) Active Transport
(3) Osmosis
(4) Facilitated Diffusion
Answer: Option (2)
Question: 107 In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as –
(1) Development
(2) Senescence
(3) Differentiation
(4) Dedifferentiation
Answer: Option (4)
Question: 108 The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
(1) Diplotene
(2) Diakinesis
(3) Zygotene
(4) Pachytene
Answer: Option (4)
Question: 109 Given below are two statements :
Statement I : The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height.
Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling.
In the light of the above statements, choose the most appropriate answer from the options given below :
(1) Statement I is correct but Statement II is incorrect.
(2) Statement I is incorrect but Statement II is correct.
(3) Both Statement I and Statement II are correct.
(4) Both Statement I and Statement II are incorrect.
Answer: Option (3)
Question: 110 Axile placentation is observed in
(1) Tomato, Dianthus and Pea
(2) China rose, Petunia and Lemon
(3) Mustard, Cucumber and Primrose
(4) China rose, Beans and Lupin
Answer: Option (2)
Question: 111 Which of the following stages of meiosis involves division of centromere?
(1) Anaphase II
(2) Telophase
(3) Metaphase I
(4) Metaphase II
Answer: Option (1)
Question: 112 Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
(1) Alfred Sturtevant
(2) Henking
(3) Thomas Hunt Morgan
(4) Sutton and Boveri
Answer: Option (1)
Question: 113 Cellulose does not form blue colour with Iodine because
(1) It does not contain complex helices and hence cannot hold iodine molecules.
(2) It breakes down when iodine reacts with it.
(3) It is a disaccharide.
(4) It is a helical molecule.
Answer: Option (1)
Question: 114 In gene gun method used to introduce alien DNA into host cells, microparticles of
\_\_\_\_ metal are used.
(1) Tungsten or gold
(2) Silver
(3) Copper
(4) Zinc
Answer: Option (1)
Question: 115 Identify the pair of heterosporous pteridophytes among the following :
(1) Psilotum and Salvinia
(2) Equisetum and Salvinia
(3) Lycopodium and Selaginella
(4) Selaginella and Salvinia
Answer: Option (4)
Question: 116 Unequivocal proof that DNA is the genetic material was first proposed by
(1) Avery, Macleoid and McCarthy
(2) Wilkins and Franklin
(3) Frederick Griffith
(4) Alfred Hershey and Martha Chase
Answer: Option (4)
Question: 117 How many ATP and \mathrm{NADPH}_{2} are required for the synthesis of one molecule of Glucose during Calvin cycle?
(1) 12 ATP and 16 \mathrm{NADPH}_{2}
(2) 18 ATP and 16 \mathrm{NADPH}_{2}
(3) 12 ATP and 12 \mathrm{NADPH}_{2}
(4) 18 ATP and 12 \mathrm{NADPH}_{2}
Answer: Option (4)
Question: 118 Identify the correct statements :
A. Detrivores perform fragmentation.
B. The humus is further degraded by some microbes during mineralization.
C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching.
D. The detritus food chain begins with living organisms.
E. Earthworms break down detritus into smaller particles by a process called catabolism.
Choose the correct answer from the options given below :
(1) C, D, E only
(2) D, E, A only
(3) A, B, C only
(4) B, C, D only
Answer: Option (3)
Question: 119 In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :
(1) Synergids, Zygote and Primary endosperm nucleus
(2) Synergids, antipodals and Polar nuclei
(3) Synergids, Primary endosperm nucleus and zygote
(4) Antipodals, synergids, and primary endosperm nucleus
Answer: Option (1)
Question: 120 Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : ATP is used at two steps in glycolysis.
Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6phosphate into fructose-1-6-diphosphate.
In the light of the above statements, choose the correct answer from the options given below :
(1) \mathbf{A} is true but \mathbf{R} is false.
(2) \mathbf{A} is false but \mathbf{R} is true.
(3) Both \mathbf{A} and \mathbf{R} are true and \mathbf{R} is the correct explanation of \mathbf{A}.
(4) Both \mathbf{A} and \mathbf{R} are true but \mathbf{R} is NOT the correct explanation of \mathbf{A}.
Answer: Option (3)
Question: 121 Expressed Sequence Tags (ESTs) refers to
(1) All genes whether expressed or unexpressed.
(2) Certain important expressed genes.
(3) All genes that are expressed as RNA.
(4) All genes that are expressed as proteins.
Answer: Option (3)
Question: 122 Among eukaryotes, replication of DNA takes place in –
(1) G_{1} phase
(2) \mathrm{G}_{2} phase
(3) M phase
(4) S phase
Answer: Option (4)
Question: 123 Given below are two statements :
Statement I: Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.
Statement II: Exarch condition is the most common feature of the root system.
In the light of the above statements, choose the correct answer from the options given below :
(1) Statement I is correct but Statement II is false.
(2) Statement I is incorrect but Statement II is true.
(3) Both Statement I and Statement II are true.
(4) Both Statement I and Statement II are false.
Answer: Option (2)
Question: 124 Large, colourful, fragrant flowers with nectar are seen in :
(1) bat pollinated plants
(2) wind pollinated plants
(3) insect pollinated plants
(4) bird pollinated plants
Answer: Option (3)
Question: 125 Which hormone promotes internode/petiole elongation in deep water rice?
(1) Ethylene
(2) 2,4-\mathrm{D}
(3) \mathrm{GA}_{3}
(4) Kinetin
Answer: Option (1)
Question: 126 Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem.
Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves.
In the light of the above statements, choose the correct answer from the options given below :
(1) \mathbf{A} is true but \mathbf{R} is false.
(2) \mathbf{A} is false but \mathbf{R} is true.
(3) Both \mathbf{A} and \mathbf{R} are true and R is the correct explanation of \mathbf{A}.
(4) Both \mathbf{A} and \mathbf{R} are true but \mathbf{R} is NOT the correct explanation of \mathbf{A}.
Answer: Option (3)
Question: 127 Match List I with List II :
| List I | List II |
|---|---|
| A. M Phase | I. Proteins are synthesized |
| B. \mathrm{G}_{2} Phase | II. Inactive phase |
| C. Quiescent stage | III. Interval between mitosis and initiation of DNA replication |
| IV. Equational division |
Choose the correct answer from the options given below :
(1) A-IV, B-I, C-II, D-III
(2) A-II, B-IV, C-I, D-III
(3) A-III, B-II, C-IV, D-I
(4) A-IV, B-II, C-I, D-III
Answer: Option (1)
Question: 128 How many different proteins does the ribosome consist of?
(1) 40
(2) 20
(3) 80
(4) 60
Answer: Option (3)
Question: 129 Which one of the following statements is NOT correct?
(1) Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbalance in the ecosystem dynamics of the water body.
(2) The amount of some toxic substances of industrial waste water increases in the organisms at successive trophic levels.
(3) The micro-organisms involved in biodegradation of organic matter in a sewage polluted water body consume a lot of oxygen causing the death of aquatic organisms.
(4) Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries.
Answer: Option (4)
Question: 130 Which of the following combinations is required for chemiosmosis?
(1) proton pump, electron gradient, ATP synthase
(2) proton pump, electron gradient, NADP synthase
(3) membrane, proton pump, proton gradient, ATP synthase
(4) membrane, proton pump, proton gradient, NADP synthase
Answer: Option (3)
Question: 131 Match List I with List II :
| List I | List II |
|---|---|
| A. Cohesion | I. More attraction in liquid phase |
| B. Adhesion | II. Mutual attraction among water molecules |
| C. Surface tension | III. Water loss in liquid phase |
| D. Guttation | IV. Attraction towards polar surfaces |
Choose the correct answer from the options given below :
(1) A-III, B-I, C-IV, D-II
(2) A-II, B-I, C-IV, D-III
(3) A-II, B-IV, C-I, D-III
(4) A-IV, B-III, C-II, D-I
Answer: Option (3)
Question: 132 Match List I with List II :
| List I | List II |
|---|---|
| A. Iron | I. Synthesis of auxin |
| B. Zinc | II. Component of nitrate reductase |
| C. Boron | III. Activator of catalase |
| D. Molybdenum | IV. Cell elongation and differentiation |
Choose the correct answer from the options given below :
(1) A-III, B-I, C-IV, D-II
(2) A-II, B-IV, C-I, D-III
(3) A-III, B-II, C-I, D-IV
(4) A-II, B-III, C-IV, D-I
Answer: Option (1)
Question: 133 Given below are two statements :
Statement I : Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually.
Statement II : In general, carnivores are more adversely affected by competition than herbivores.
In the light of the above statements, choose the correct answer from the options given below :
(1) Statement I is correct but Statement II is false.
(2) Statement I is incorrect but Statement II is true.
(3) Both Statement I and Statement II are true.
(4) Both Statement I and Statement II are false.
Answer: Option (1)
Question: 134 Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of
(1) Lipase
(2) Dinitrogenase
(3) Succinic dehydrogenase
(4) Amylase
Answer: Option (3)
Question: 135 Identify the correct statements :
A. Lenticels are the lens-shaped openings permitting the exchange of gases.
B. Bark formed early in the season is called hard bark.
C. Bark is a technical term that refers to all tissues exterior to vascular cambium.
D. Bark refers to periderm and secondary phloem.
E. Phellogen is single-layered in thickness.
Choose the correct answer from the options given below :
(1) A, B and D only
(2) B and C only
(3) B, C and E only
(4) A and D only
Answer: Option (4)
Question: 136 Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents.
Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed.
In the light of the above statements, choose the correct answer from the options given below :
(1) \mathbf{A} is true but \mathbf{R} is false.
(2) \mathbf{A} is false but \mathbf{R} is true.
(3) Both \mathbf{A} and \mathbf{R} are true and \mathbf{R} is the correct explanation of \mathbf{A}.
(4) Both \mathbf{A} and \mathbf{R} are true but \mathbf{R} is NOT the correct explanation of \mathbf{A}.
Answer: Option (1)
Question: 137 Which of the following statements are correct about Klinefelter’s Syndrome?
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine development is also expressed.
C. The affected individual is short statured.
D. Physical, psychomotor and mental development is retarded.
E. Such individuals are sterile.
Choose the correct answer from the options given below :
(1) B and E only
(2) A and E only
(3) A and B only
(4) C and D only
Answer: Option (1)
Question: 138 Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence.
A. Insertion of recombinant DNA into the host cell.
B. Cutting of DNA at specific location by restriction enzyme.
C. Isolation of desired DNA fragment.
D. Amplification of gene of interest using PCR.
Choose the correct answer from the options given below :
(1) \mathrm{C}, \mathrm{B}, \mathrm{D}, \mathrm{A}
(2) \mathrm{B}, \mathrm{D}, \mathrm{A}, \mathrm{C}
(3) \mathrm{B}, \mathrm{C}, \mathrm{A}, \mathrm{D}
(4) \mathrm{C}, \mathrm{A}, \mathrm{B}, \mathrm{D}
Answer: Option (1)
Question: 139 Match List I with List II :
| List I | List II |
|---|---|
| A. Oxidative decarboxylation | I. Citrate synthase |
| B. Glycolysis | II. Pyruvate dehydrogenase |
| C. Oxidative phosphorylation | III. Electron transport system |
| D. Tricarboxylic acid cycle | IV. EMP pathway |
Choose the correct answer from the options given below :
(1) A-III, B-I, C-II, D-IV
(2) A-II, B-IV, C-III, D-I
(3) A-III, B-IV, C-II, D-I
(4) A-II, B-IV, C-I, D-III
Answer: Option (2)
Question: 140 Match List I with List II :
| List I (Interaction) | List II (Species A and B) |
|---|---|
| A. Mutualism | I. +(\mathrm{A}), \mathrm{O}(\mathrm{B}) |
| B. Commensalism | II. -(\mathrm{A}), \mathrm{O}(\mathrm{B}) |
| C. Amensalism | III. +(\mathrm{A}),-(\mathrm{B}) |
| D. Parasitism | IV. +(\mathrm{A}),+(\mathrm{B}) |
Choose the correct answer from the options given below :
(1) A-IV, B-III, C-I, D-II
(2) A-III, B-I, C-IV, D-II
(3) A-IV, B-II, C-I, D-III
(4) A-IV, B-I, C-II, D-III
Answer: Option (4)
Question: 141 Broad palm with single palm crease is visible in a person suffering from-
(1) Klinefelter’s syndrome
(2) Thalassemia
(3) Down’s syndrome
(4) Turner’s syndrome
Answer: Option (3)
Question: 142 Given below are two statements:
Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal)
Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of \alpha type and two subunits of \beta type.)
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is true but Statement II is false.
(2) Statement I is false but Statement II is true.
(3) Both Statement I and Statement II are true.
(4) Both Statement I and Statement II are false.
Answer: Option (2)
Question: 143 Given below are statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla.
Reason R: Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle.
In the light of the above statements, choose the correct answer from the options given below:
(1) \mathbf{A} is true but \mathbf{R} is false.
(2) \mathbf{A} is false but \mathbf{R} is true.
(3) Both \mathbf{A} and \mathbf{R} are true and \mathbf{R} is the correct explanation of \mathbf{A}.
(4) Both \mathbf{A} and \mathbf{R} are true but \mathbf{R} is NOT the correct explanation of \mathbf{A}.
Answer: Option (1)
Question: 144 Vital capacity of lung is \_\_\_\_ .
(1) \mathrm{IRV}+\mathrm{ERV}+\mathrm{TV}-\mathrm{RV}
(2) \mathrm{IRV}+\mathrm{ERV}+\mathrm{TV}
(3) \mathrm{IRV}+\mathrm{ERV}
(4) \mathrm{IRV}+\mathrm{ERV}+\mathrm{TV}+\mathrm{RV}
Answer: Option (2)
Question: 145 Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?
(1) Hepatitis-B
(2) HIV Infection
(3) Genital herpes
(4) Gonorrhoea
Answer: Option (4)
Question: 146 Which of the following are NOT considered as the part of endomembrane system?
A. Mitochondria
B. Endoplasmic Reticulum
C. Chloroplasts
D. Golgi complex
E. Peroxisomes
Choose the most appropriate answer from the options given below:
(1) A and D only
(2) A, D and E only
(3) B and D only
(4) A, C and E only
Answer: Option (4)
Question: 147 Which of the following is not a cloning vector?
(1) pBR322
(2) Probe
(3) BAC
(4) YAC
Answer: Option (2)
Question: 148 Match List I with List II.
| List I (Interacting species) | List II (Name of Interaction) |
|---|---|
| A. A Leopard and a Lion in a forest/ grassland | I. Competition |
| B. A Cuckoo laying egg in a Crow’s nest | II. Brood parasitism |
| C. Fungi and root of a higher plant in Mycorrtizae | III. Mutualism |
| D. A cattle egret and a Cattle in a field | IV. Commensalism |
Choose the correct answer from the options given below:
(1) A-III, B-IV, C-I, D-II
(2) A-II, B-III, C-I, D-IV
(3) A-I, B-II, C-III, D-IV
(4) A-I, B-II, C-IV, D-III
Answer: Option (3)
Question: 149 Match List I with List II.
| List I | List II |
|---|---|
| A. Taenia | I. Nephridia |
| B. Paramoecium | II. Contractile vacuole |
| C. Periplaneta | III. Flame cells |
| D. Pheretima | IV. Urecose gland |
Choose the correct answer from the options give below:
(1) A-III, B-II, C-IV, D-I
(2) A-II, B-I, C-IV, D-III
(3) A-I, B-II, C-III, D-IV
(4) A-I, B-II, C-IV, D-III
Answer: Option (1)
Question: 150 Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by-
(1) Gastro – oesophageal sphincter
(2) Pyloric sphincter
(3) Sphincter of Oddi
(4) Ileo – caecal valve
Answer: Option (4)
Question: 151 Match List I with List II.
| List I | List II |
|---|---|
| A. Gene ‘a’ | I. \beta-galactosidase |
| B. Gene ‘y’ | II. Transacetylase |
| C. Gene ‘ i ‘ | III. Permease |
| D. Gene ‘z’ | IV. Repressor protein |
Choose the correct answer from the options given below:
(1) A-III, B-IV, C-I, D-II
(2) A-III, B-I, C-IV, D-II
(3) A-II, B-I, C-IV, D-III
(4) A-II, B-III, C-IV, D-I
Answer: Option (4)
Question: 152 Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?
(1) Polymerase Chain Reaction (PCR) technique
(2) Enzyme Linked Immuno-Sorbent Assay (ELISA) technique
(3) Recombinant DNA Technology
(4) Serum and Urine analysis
Answer: Option (4)
Question: 153 Given below are two statements:
Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.
Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is true but Statement II is false.
(2) Statement I is false but Statement II is true.
(3) Both Statement I and Statement II are true.
(4) Both Statement I and Statement II are false.
Answer: Option (3)
Question: 154 Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Endometrium is necessary for implantation of blastocyst.
Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium.
In the light of the above statements, choose the correct answer from the options given below:
(1) \mathbf{A} is true but \mathbf{R} is false.
(2) \mathbf{A} is false but \mathbf{R} is true.
(3) Both \mathbf{A} and \mathbf{R} are true and \mathbf{R} is the correct explanation of \mathbf{A}.
(4) Both \mathbf{A} and \mathbf{R} are true but \mathbf{R} is NOT the correct explanation of \mathbf{A}.
Answer: Option (4)
Question: 155 Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme.
Reason R: Ban on amniocentesis checks increasing menace of female foeticide.
In the light of the above statements, choose the correct answer from the options given below:
(1) \mathbf{A} is true but \mathbf{R} is false.
(2) \mathbf{A} is false but \mathbf{R} is true.
(3) Both \mathbf{A} and \mathbf{R} are true and \mathbf{R} is the correct explanation of \mathbf{A}.
(4) Both \mathbf{A} and \mathbf{R} are true and \mathbf{R} is NOT the correct explanation of \mathbf{A}.
Answer: Option (2)
Question: 156 Which of the following statements is correct?
(1) Presence of large amount of nutrients in water restricts ‘Algal Bloom’
(2) Algal Bloom decreases fish mortality
(3) Eutrophication refers to increase in domestic sewage and waste water in lakes.
(4) Biomagnification refers to increase in concentration of the toxicant at successive trophic levels.
Answer: Option (4)
Question: 157 Which of the following statements are correct regarding female reproductive cycle?
A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
B. First menstrual cycle begins at puberty and is called menopause.
C. Lack of menstruation may be indicative of pregnancy.
D. Cyclic menstruation extends between menarche and menopause.
Choose the most appropriate answer from the options given below:
(1) A, B and C only
(2) A, C and D only
(3) A and D only
(4) A and B only
Answer: Option (2)
Question: 158 Match List I with List II.
| List I | List II |
|---|---|
| A. CCK | I. Kidney |
| B. GIP | II. Heart |
| C. ANF | III. Gastric gland |
| D. ADH | IV. Pancreas |
Choose the correct answer from the options given below:
(1) A-II, B-IV, C-I, D-III
(2) A-IV, B-II, C-III, D-I
(3) A-IV, B-III, C-II, D-I
(4) A-III, B-II, C-IV, D-I
Answer: Option (3)
Question: 159 Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is correct but Statement II is false.
(2) Statement I incorrect but Statement II is true.
(3) Both Statement I and Statement II are true.
(4) Both Statement I and Statement II are false.
Answer: Option (2)
Question: 160 Match List I with List II.
| List I(Type of Joint) | List II(Found between) |
|---|---|
| A. Cartilaginous Joint | I. Between flat skull bones |
| B. Ball and Socket Joint | II. Between adjacent vertebrae in vertebral column |
| C. Fibrous Joint | III. Between carpal and metacarpal of thumb |
| D. Saddle Joint | IV. Between Humerus and Pectoral girdle |
Choose the correct answer from the options given below:
(1) A-I, B-IV, C-III, D-II
(2) A-II, B-IV, C-III, D-I
(3) A-III, B-I, C-II, D-IV
(4) A-II, B-IV, C-I, D-III
Answer: Option (4)
Question: 161 Given below are two statements:
Statement I: Ligaments are dense irregular tissue.
Statement II: Cartilage is dense regular tissue.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is true but Statement II is false.
(2) Statement I is false but Statement II is true.
(3) Both Statement I and Statement II are true.
(4) Both Statement I and Statement II are false.
Answer: Option (4)
Question: 162 In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
(1) Basophils
(2) Eosinophils
(3) \mathrm{T}_{\mathrm{H}} cells
(4) B-lymphocytes
Answer: Option (3)
Question: 163 Radial symmetry is NOT found in adults of phylum \_\_\_\_ .
(1) Coelenterata
(2) Echinodermata
(3) Ctenophora
(4) Hemichordata
Answer: Option (4)
Question: 164 Which of the following functions is carried out by cytoskeleton in a cell?
(1) Motility
(2) Transportation
(3) Nuclear division
(4) Protein synthesis
Answer: Option (1)
Question: 165 Given below are two statements:
Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct.
Statement II: The cavity of the cervix is called cervical canal which along with vagina forms birth canal.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is correct but Statement II is false.
(2) Statement I incorrect but Statement II is true.
(3) Both Statement I and Statement II are true.
(4) Both Statement I and Statement II are false.
Answer: Option (3)
Question: 166 Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
(1) Mole, Flying squirrel, Tasmanian tiger cat
(2) Lemur, Anteater, Wolf
(3) Tasmanian wolf, Bobcat, Marsupial mole
(4) Numbat, Spotted cuscus, Flying phalanger
Answer: Option (4)
Question: 167 Given below are two statements:
Statement I: Electrostatic precipitator is most widely used in thermal power plant.
Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations.
In the light of the above statements, choose the most appropriate answer from the options given below:
(1) Statement I is correct but Statement II is incorrect.
(2) Statement I incorrect but Statement II is correct.
(3) Both Statement I and Statement II are correct.
(4) Both Statement I and Statement II are incorrect.
Answer: Option (1)
Question: 168 Given below are two statements:
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is true but Statement II is false.
(2) Statement I false but Statement II is true.
(3) Both Statement I and Statement II are true.
(4) Both Statement I and Statement II are false.
Answer: Option (3)
Question: 169 Match List I with List II with respect to human eye.
| List I | List II |
|---|---|
| A. Fovea | I. Visible coloured portion of eye that regulates diameter of pupil. |
| B. Iris | II. External layer of eye formed of dense connective tissue. |
| C. Blind spot | III. Point of greatest visual acuity or resolution. |
| D. Sclera | IV. Point where optic nerve leaves the eyeball and photoreceptor cells are absent. |
Choose the correct answer from the options given below:
(1) A-I, B-IV, C-III, D-II
(2) A-II, B-I, C-III, D-IV
(3) A-III, B-I, C-IV, D-II
(4) A-IV, B-III, C-II, D-I
Answer: Option (3)
Question: 170 Select the correct statements.
A. Tetrad formation is seen during Leptotene.
B. During Anaphase, the centromeres split and chromatids separate.
C. Terminalization takes place during Pachytene.
D. Nucleolus, Golgi complex and ER are reformed during Telophase.
E. Crossing over takes place between sister chromatids of homologous chromosome.
Choose the correct answer from the options given below:
(1) A, C and E only
(2) B and E only
(3) A and C only
(4) B and D only
Answer: Option (4)
Question: 171 Select the correct statements with reference to chordates.
A. Presence of a mid-dorsal, solid and double nerve cord.
B. Presence of closed circulatory system.
C. Presence of paired pharyngeal gillslits.
D. Presence of dorsal heart
E. Triploblastic pseudocoelomate animals.
Choose the correct answer from the options given below:
(1) B, D and E only
(2) C, D and E only
(3) A, C and D only
(4) B and C only
Answer: Option (4)
Question: 172 In cockroach, excretion is brought about by-
A. Phallic gland
B. Urecose gland
C. Nephrocytes
D. Fat body
E. Collaterial glands
Choose the correct answer from the options given below:
(1) B, C and D only
(2) B and D only
(3) A and E only
(4) A, B and E only
Answer: Option (1)
Question: 173 Match List I with List II.
| List I | List II |
|---|---|
| A. Mast cells | I. Ciliated epithelium |
| B. Inner surface of bronchiole | II. Areolar connective tissue |
| C. Blood | III. Cuboidal epithelium |
| D. Tubular parts of nephron | IV. specialised connective tissue |
Choose the correct answer from the options give below:
(1) A-II, B-I, C-IV, D-III
(2) A-III, B-IV, C-II, D-I
(3) A-I, B-II, C-IV, D-III
(4) A-II, B-III, C-I, D-IV
Answer: Option (1)
Question: 174 Given below are two statements:
Statement I: During \mathrm{G}_{0} phase of cell cycle, the cell is metabolically inactive.
Statement II: The centrosome undergoes duplication during S phase of interphase.
In the light of the above statements, choose the most appropriate answer from the options given below:
(1) Statement I is correct but Statement II is incorrect.
(2) Statement I is incorrect but Statement II is correct.
(3) Both Statement I and Statement II are correct.
(4) Both Statement I and Statement II are incorrect.
Answer: Option (2)
Question: 175 Which one of the following is NOT an advantage of inbreeding?
(1) Elimination of less desirable genes and accumulation of superior genes takes place due to it.
(2) It decreases the productivity of inbred population, after continuous inbreeding.
(3) It decreases homozygosity.
(4) It exposes harmful recessive genes that are eliminated by selection.
Answer: Option (2)
Question: 176 Which of the following is characteristic feature of cockroach regarding sexual dimorphism ?
(1) Presence of sclerites
(2) Presence of anal cerci
(3) Dark brown body colour and anal cerci
(4) Presence of anal styles
Answer: Option (4)
Question: 177 The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are :
(1) Brain stem & epithalamus
(2) Corpus callosum and thalamus
(3) Limbic system & hypothalamus
(4) Corpora quadrigemina & hippocampus
Answer: Option (3)
Question: 178 Which of the following statements are correct ?
A. Basophils are most abundant cells of the total WBCs
B. Basophils secrete histamine, serotonin and heparin
C. Basophils are involved in inflammatory response
D. Basophils have kidney shaped nucleus
E. Basophils are agranulocytes
Choose the correct answer from the options given below:
(1) B and C only
(2) A and B only
(3) D and E only
(4) C and E only
Answer: Option (1)
Question: 179 Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
5′ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3′?
(1) 5 , ATCGATCGATCGATCGATCG ATCGATCG 3′
(2) 3′ ATCGATCGATCGATCGATCG ATCGATCG 5^{\prime}
(3) 5 , UAGCUAGCUAGCUAGCUA GCUAGC UAGC 3′
(4) 3 ‘ UAGCUAGCUAGCUAGCUA GCUAGCUAGC 5^{\prime}
Answer: Option (1)
Question: 180 Which of the following are NOT under the control of thyroid hormone?
A. Maintenance of water and electrolyte balance
B. Regulation of basal metabolic rate
C. Normal rhythm of sleep-wake cycle
D. Development of immune system
E. Support the process of R.B.Cs formation
Choose the correct answer from the options given below:
(1) C and D only
(2) D and E only
(3) A and D only
(4) B and C only
Answer: Option (1)